Kotlin - Nucleotide Count WIP
This commit is contained in:
anthony.cicchetti
parent
ccec7f9343
commit
75d31918b9
62 changed files with 3548 additions and 12 deletions
BIN
kotlin/beer-song/.gradle/3.5/file-changes/last-build.bin
Normal file
BIN
kotlin/beer-song/.gradle/3.5/file-changes/last-build.bin
Normal file
Binary file not shown.
BIN
kotlin/beer-song/.gradle/3.5/taskHistory/taskHistory.lock
Normal file
BIN
kotlin/beer-song/.gradle/3.5/taskHistory/taskHistory.lock
Normal file
Binary file not shown.
0
kotlin/beer-song/.gradle/buildOutputCleanup/built.bin
Normal file
0
kotlin/beer-song/.gradle/buildOutputCleanup/built.bin
Normal file
|
|
@ -0,0 +1,2 @@
|
|||
#Mon Jun 05 12:43:15 EDT 2017
|
||||
gradle.version=3.5
|
||||
|
|
@ -0,0 +1 @@
|
|||
|
||||
9
kotlin/beer-song/.idea/compiler.xml
generated
Normal file
9
kotlin/beer-song/.idea/compiler.xml
generated
Normal file
|
|
@ -0,0 +1,9 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="CompilerConfiguration">
|
||||
<bytecodeTargetLevel>
|
||||
<module name="beer-song_main" target="1.8" />
|
||||
<module name="beer-song_test" target="1.8" />
|
||||
</bytecodeTargetLevel>
|
||||
</component>
|
||||
</project>
|
||||
19
kotlin/beer-song/.idea/gradle.xml
generated
Normal file
19
kotlin/beer-song/.idea/gradle.xml
generated
Normal file
|
|
@ -0,0 +1,19 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="GradleSettings">
|
||||
<option name="linkedExternalProjectsSettings">
|
||||
<GradleProjectSettings>
|
||||
<option name="distributionType" value="LOCAL" />
|
||||
<option name="externalProjectPath" value="$PROJECT_DIR$" />
|
||||
<option name="gradleHome" value="C:/Gradle/gradle-3.5" />
|
||||
<option name="gradleJvm" value="#JAVA_HOME" />
|
||||
<option name="modules">
|
||||
<set>
|
||||
<option value="$PROJECT_DIR$" />
|
||||
</set>
|
||||
</option>
|
||||
<option name="useAutoImport" value="true" />
|
||||
</GradleProjectSettings>
|
||||
</option>
|
||||
</component>
|
||||
</project>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: junit:junit:4.12">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/junit/junit/4.12/2973d150c0dc1fefe998f834810d68f278ea58ec/junit-4.12.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/junit/junit/4.12/a6c32b40bf3d76eca54e3c601e5d1470c86fcdfa/junit-4.12-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.hamcrest:hamcrest-core:1.3">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.hamcrest/hamcrest-core/1.3/42a25dc3219429f0e5d060061f71acb49bf010a0/hamcrest-core-1.3.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.hamcrest/hamcrest-core/1.3/1dc37250fbc78e23a65a67fbbaf71d2e9cbc3c0b/hamcrest-core-1.3-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains:annotations:13.0">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains/annotations/13.0/919f0dfe192fb4e063e7dacadee7f8bb9a2672a9/annotations-13.0.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains/annotations/13.0/5991ca87ef1fb5544943d9abc5a9a37583fabe03/annotations-13.0-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-stdlib/1.1.1/98e484e67f913e934559f7f55f0c94be5593f03c/kotlin-stdlib-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-stdlib/1.1.1/a287944d92875a1f3c2161e5cddaede7720913d1/kotlin-stdlib-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-test:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test/1.1.1/5a852a554eb4f9fb93efdffa352b7983ed595e32/kotlin-test-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test/1.1.1/4b9a869f86569edea4a07d19b9749ac835fb7207/kotlin-test-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
generated
Normal file
11
kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-test-junit:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test-junit/1.1.1/a1865f59b6f72597452e5bdfefeb14d13bc31c7d/kotlin-test-junit-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test-junit/1.1.1/ed59de63c4565c708124caaa4e86562a780f9ba0/kotlin-test-junit-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
22
kotlin/beer-song/.idea/misc.xml
generated
Normal file
22
kotlin/beer-song/.idea/misc.xml
generated
Normal file
|
|
@ -0,0 +1,22 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="ProjectRootManager" version="2" languageLevel="JDK_1_8" project-jdk-name="Java 1.8" project-jdk-type="JavaSDK">
|
||||
<output url="file://$PROJECT_DIR$/classes" />
|
||||
</component>
|
||||
<component name="masterDetails">
|
||||
<states>
|
||||
<state key="ProjectJDKs.UI">
|
||||
<settings>
|
||||
<last-edited>1.8</last-edited>
|
||||
<splitter-proportions>
|
||||
<option name="proportions">
|
||||
<list>
|
||||
<option value="0.2" />
|
||||
</list>
|
||||
</option>
|
||||
</splitter-proportions>
|
||||
</settings>
|
||||
</state>
|
||||
</states>
|
||||
</component>
|
||||
</project>
|
||||
10
kotlin/beer-song/.idea/modules.xml
generated
Normal file
10
kotlin/beer-song/.idea/modules.xml
generated
Normal file
|
|
@ -0,0 +1,10 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="ProjectModuleManager">
|
||||
<modules>
|
||||
<module fileurl="file://$PROJECT_DIR$/beer-song.iml" filepath="$PROJECT_DIR$/beer-song.iml" />
|
||||
<module fileurl="file://$PROJECT_DIR$/.idea/modules/beer-song_main.iml" filepath="$PROJECT_DIR$/.idea/modules/beer-song_main.iml" group="beer-song" />
|
||||
<module fileurl="file://$PROJECT_DIR$/.idea/modules/beer-song_test.iml" filepath="$PROJECT_DIR$/.idea/modules/beer-song_test.iml" group="beer-song" />
|
||||
</modules>
|
||||
</component>
|
||||
</project>
|
||||
40
kotlin/beer-song/.idea/modules/beer-song_main.iml
generated
Normal file
40
kotlin/beer-song/.idea/modules/beer-song_main.iml
generated
Normal file
|
|
@ -0,0 +1,40 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="beer-song:main" external.linked.project.path="$MODULE_DIR$/../.." external.root.project.path="$MODULE_DIR$/../.." external.system.id="GRADLE" external.system.module.group="" external.system.module.type="sourceSet" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="FacetManager">
|
||||
<facet type="kotlin-language" name="Kotlin">
|
||||
<configuration version="2" platform="JVM 1.6" useProjectSettings="false">
|
||||
<compilerSettings />
|
||||
<compilerArguments>
|
||||
<option name="noStdlib" value="true" />
|
||||
<option name="noReflect" value="true" />
|
||||
<option name="moduleName" value="beer-song_main" />
|
||||
<option name="jvmTarget" value="1.6" />
|
||||
<option name="addCompilerBuiltIns" value="true" />
|
||||
<option name="loadBuiltInsFromDependencies" value="true" />
|
||||
<option name="languageVersion" value="1.1" />
|
||||
<option name="apiVersion" value="1.1" />
|
||||
<option name="pluginClasspaths">
|
||||
<array />
|
||||
</option>
|
||||
<option name="coroutinesWarn" value="true" />
|
||||
<option name="pluginOptions">
|
||||
<array />
|
||||
</option>
|
||||
</compilerArguments>
|
||||
</configuration>
|
||||
</facet>
|
||||
</component>
|
||||
<component name="NewModuleRootManager" LANGUAGE_LEVEL="JDK_1_8">
|
||||
<output url="file://$MODULE_DIR$/../../build/classes/main" />
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$/../../src/main">
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/java" isTestSource="false" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/kotlin" isTestSource="false" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/resources" type="java-resource" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains:annotations:13.0" level="project" />
|
||||
</component>
|
||||
</module>
|
||||
46
kotlin/beer-song/.idea/modules/beer-song_test.iml
generated
Normal file
46
kotlin/beer-song/.idea/modules/beer-song_test.iml
generated
Normal file
|
|
@ -0,0 +1,46 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="beer-song:test" external.linked.project.path="$MODULE_DIR$/../.." external.root.project.path="$MODULE_DIR$/../.." external.system.id="GRADLE" external.system.module.group="" external.system.module.type="sourceSet" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="FacetManager">
|
||||
<facet type="kotlin-language" name="Kotlin">
|
||||
<configuration version="2" platform="JVM 1.6" useProjectSettings="false">
|
||||
<compilerSettings />
|
||||
<compilerArguments>
|
||||
<option name="noStdlib" value="true" />
|
||||
<option name="noReflect" value="true" />
|
||||
<option name="moduleName" value="beer-song_main" />
|
||||
<option name="jvmTarget" value="1.6" />
|
||||
<option name="addCompilerBuiltIns" value="true" />
|
||||
<option name="loadBuiltInsFromDependencies" value="true" />
|
||||
<option name="languageVersion" value="1.1" />
|
||||
<option name="apiVersion" value="1.1" />
|
||||
<option name="pluginClasspaths">
|
||||
<array />
|
||||
</option>
|
||||
<option name="coroutinesWarn" value="true" />
|
||||
<option name="pluginOptions">
|
||||
<array />
|
||||
</option>
|
||||
</compilerArguments>
|
||||
</configuration>
|
||||
</facet>
|
||||
</component>
|
||||
<component name="NewModuleRootManager" LANGUAGE_LEVEL="JDK_1_8">
|
||||
<output-test url="file://$MODULE_DIR$/../../build/classes/test" />
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$/../../src/test">
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/java" isTestSource="true" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/kotlin" isTestSource="true" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/resources" type="java-test-resource" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
<orderEntry type="module" module-name="beer-song_main" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: junit:junit:4.12" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-test-junit:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains:annotations:13.0" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.hamcrest:hamcrest-core:1.3" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-test:1.1.1" level="project" />
|
||||
</component>
|
||||
<component name="TestModuleProperties" production-module="beer-song_main" />
|
||||
</module>
|
||||
1030
kotlin/beer-song/.idea/workspace.xml
generated
Normal file
1030
kotlin/beer-song/.idea/workspace.xml
generated
Normal file
File diff suppressed because it is too large
Load diff
329
kotlin/beer-song/README.md
Normal file
329
kotlin/beer-song/README.md
Normal file
|
|
@ -0,0 +1,329 @@
|
|||
# Beer Song
|
||||
|
||||
Produce the lyrics to that beloved classic, that field-trip favorite: 99 Bottles of Beer on the Wall.
|
||||
|
||||
Note that not all verses are identical.
|
||||
|
||||
```plain
|
||||
99 bottles of beer on the wall, 99 bottles of beer.
|
||||
Take one down and pass it around, 98 bottles of beer on the wall.
|
||||
|
||||
98 bottles of beer on the wall, 98 bottles of beer.
|
||||
Take one down and pass it around, 97 bottles of beer on the wall.
|
||||
|
||||
97 bottles of beer on the wall, 97 bottles of beer.
|
||||
Take one down and pass it around, 96 bottles of beer on the wall.
|
||||
|
||||
96 bottles of beer on the wall, 96 bottles of beer.
|
||||
Take one down and pass it around, 95 bottles of beer on the wall.
|
||||
|
||||
95 bottles of beer on the wall, 95 bottles of beer.
|
||||
Take one down and pass it around, 94 bottles of beer on the wall.
|
||||
|
||||
94 bottles of beer on the wall, 94 bottles of beer.
|
||||
Take one down and pass it around, 93 bottles of beer on the wall.
|
||||
|
||||
93 bottles of beer on the wall, 93 bottles of beer.
|
||||
Take one down and pass it around, 92 bottles of beer on the wall.
|
||||
|
||||
92 bottles of beer on the wall, 92 bottles of beer.
|
||||
Take one down and pass it around, 91 bottles of beer on the wall.
|
||||
|
||||
91 bottles of beer on the wall, 91 bottles of beer.
|
||||
Take one down and pass it around, 90 bottles of beer on the wall.
|
||||
|
||||
90 bottles of beer on the wall, 90 bottles of beer.
|
||||
Take one down and pass it around, 89 bottles of beer on the wall.
|
||||
|
||||
89 bottles of beer on the wall, 89 bottles of beer.
|
||||
Take one down and pass it around, 88 bottles of beer on the wall.
|
||||
|
||||
88 bottles of beer on the wall, 88 bottles of beer.
|
||||
Take one down and pass it around, 87 bottles of beer on the wall.
|
||||
|
||||
87 bottles of beer on the wall, 87 bottles of beer.
|
||||
Take one down and pass it around, 86 bottles of beer on the wall.
|
||||
|
||||
86 bottles of beer on the wall, 86 bottles of beer.
|
||||
Take one down and pass it around, 85 bottles of beer on the wall.
|
||||
|
||||
85 bottles of beer on the wall, 85 bottles of beer.
|
||||
Take one down and pass it around, 84 bottles of beer on the wall.
|
||||
|
||||
84 bottles of beer on the wall, 84 bottles of beer.
|
||||
Take one down and pass it around, 83 bottles of beer on the wall.
|
||||
|
||||
83 bottles of beer on the wall, 83 bottles of beer.
|
||||
Take one down and pass it around, 82 bottles of beer on the wall.
|
||||
|
||||
82 bottles of beer on the wall, 82 bottles of beer.
|
||||
Take one down and pass it around, 81 bottles of beer on the wall.
|
||||
|
||||
81 bottles of beer on the wall, 81 bottles of beer.
|
||||
Take one down and pass it around, 80 bottles of beer on the wall.
|
||||
|
||||
80 bottles of beer on the wall, 80 bottles of beer.
|
||||
Take one down and pass it around, 79 bottles of beer on the wall.
|
||||
|
||||
79 bottles of beer on the wall, 79 bottles of beer.
|
||||
Take one down and pass it around, 78 bottles of beer on the wall.
|
||||
|
||||
78 bottles of beer on the wall, 78 bottles of beer.
|
||||
Take one down and pass it around, 77 bottles of beer on the wall.
|
||||
|
||||
77 bottles of beer on the wall, 77 bottles of beer.
|
||||
Take one down and pass it around, 76 bottles of beer on the wall.
|
||||
|
||||
76 bottles of beer on the wall, 76 bottles of beer.
|
||||
Take one down and pass it around, 75 bottles of beer on the wall.
|
||||
|
||||
75 bottles of beer on the wall, 75 bottles of beer.
|
||||
Take one down and pass it around, 74 bottles of beer on the wall.
|
||||
|
||||
74 bottles of beer on the wall, 74 bottles of beer.
|
||||
Take one down and pass it around, 73 bottles of beer on the wall.
|
||||
|
||||
73 bottles of beer on the wall, 73 bottles of beer.
|
||||
Take one down and pass it around, 72 bottles of beer on the wall.
|
||||
|
||||
72 bottles of beer on the wall, 72 bottles of beer.
|
||||
Take one down and pass it around, 71 bottles of beer on the wall.
|
||||
|
||||
71 bottles of beer on the wall, 71 bottles of beer.
|
||||
Take one down and pass it around, 70 bottles of beer on the wall.
|
||||
|
||||
70 bottles of beer on the wall, 70 bottles of beer.
|
||||
Take one down and pass it around, 69 bottles of beer on the wall.
|
||||
|
||||
69 bottles of beer on the wall, 69 bottles of beer.
|
||||
Take one down and pass it around, 68 bottles of beer on the wall.
|
||||
|
||||
68 bottles of beer on the wall, 68 bottles of beer.
|
||||
Take one down and pass it around, 67 bottles of beer on the wall.
|
||||
|
||||
67 bottles of beer on the wall, 67 bottles of beer.
|
||||
Take one down and pass it around, 66 bottles of beer on the wall.
|
||||
|
||||
66 bottles of beer on the wall, 66 bottles of beer.
|
||||
Take one down and pass it around, 65 bottles of beer on the wall.
|
||||
|
||||
65 bottles of beer on the wall, 65 bottles of beer.
|
||||
Take one down and pass it around, 64 bottles of beer on the wall.
|
||||
|
||||
64 bottles of beer on the wall, 64 bottles of beer.
|
||||
Take one down and pass it around, 63 bottles of beer on the wall.
|
||||
|
||||
63 bottles of beer on the wall, 63 bottles of beer.
|
||||
Take one down and pass it around, 62 bottles of beer on the wall.
|
||||
|
||||
62 bottles of beer on the wall, 62 bottles of beer.
|
||||
Take one down and pass it around, 61 bottles of beer on the wall.
|
||||
|
||||
61 bottles of beer on the wall, 61 bottles of beer.
|
||||
Take one down and pass it around, 60 bottles of beer on the wall.
|
||||
|
||||
60 bottles of beer on the wall, 60 bottles of beer.
|
||||
Take one down and pass it around, 59 bottles of beer on the wall.
|
||||
|
||||
59 bottles of beer on the wall, 59 bottles of beer.
|
||||
Take one down and pass it around, 58 bottles of beer on the wall.
|
||||
|
||||
58 bottles of beer on the wall, 58 bottles of beer.
|
||||
Take one down and pass it around, 57 bottles of beer on the wall.
|
||||
|
||||
57 bottles of beer on the wall, 57 bottles of beer.
|
||||
Take one down and pass it around, 56 bottles of beer on the wall.
|
||||
|
||||
56 bottles of beer on the wall, 56 bottles of beer.
|
||||
Take one down and pass it around, 55 bottles of beer on the wall.
|
||||
|
||||
55 bottles of beer on the wall, 55 bottles of beer.
|
||||
Take one down and pass it around, 54 bottles of beer on the wall.
|
||||
|
||||
54 bottles of beer on the wall, 54 bottles of beer.
|
||||
Take one down and pass it around, 53 bottles of beer on the wall.
|
||||
|
||||
53 bottles of beer on the wall, 53 bottles of beer.
|
||||
Take one down and pass it around, 52 bottles of beer on the wall.
|
||||
|
||||
52 bottles of beer on the wall, 52 bottles of beer.
|
||||
Take one down and pass it around, 51 bottles of beer on the wall.
|
||||
|
||||
51 bottles of beer on the wall, 51 bottles of beer.
|
||||
Take one down and pass it around, 50 bottles of beer on the wall.
|
||||
|
||||
50 bottles of beer on the wall, 50 bottles of beer.
|
||||
Take one down and pass it around, 49 bottles of beer on the wall.
|
||||
|
||||
49 bottles of beer on the wall, 49 bottles of beer.
|
||||
Take one down and pass it around, 48 bottles of beer on the wall.
|
||||
|
||||
48 bottles of beer on the wall, 48 bottles of beer.
|
||||
Take one down and pass it around, 47 bottles of beer on the wall.
|
||||
|
||||
47 bottles of beer on the wall, 47 bottles of beer.
|
||||
Take one down and pass it around, 46 bottles of beer on the wall.
|
||||
|
||||
46 bottles of beer on the wall, 46 bottles of beer.
|
||||
Take one down and pass it around, 45 bottles of beer on the wall.
|
||||
|
||||
45 bottles of beer on the wall, 45 bottles of beer.
|
||||
Take one down and pass it around, 44 bottles of beer on the wall.
|
||||
|
||||
44 bottles of beer on the wall, 44 bottles of beer.
|
||||
Take one down and pass it around, 43 bottles of beer on the wall.
|
||||
|
||||
43 bottles of beer on the wall, 43 bottles of beer.
|
||||
Take one down and pass it around, 42 bottles of beer on the wall.
|
||||
|
||||
42 bottles of beer on the wall, 42 bottles of beer.
|
||||
Take one down and pass it around, 41 bottles of beer on the wall.
|
||||
|
||||
41 bottles of beer on the wall, 41 bottles of beer.
|
||||
Take one down and pass it around, 40 bottles of beer on the wall.
|
||||
|
||||
40 bottles of beer on the wall, 40 bottles of beer.
|
||||
Take one down and pass it around, 39 bottles of beer on the wall.
|
||||
|
||||
39 bottles of beer on the wall, 39 bottles of beer.
|
||||
Take one down and pass it around, 38 bottles of beer on the wall.
|
||||
|
||||
38 bottles of beer on the wall, 38 bottles of beer.
|
||||
Take one down and pass it around, 37 bottles of beer on the wall.
|
||||
|
||||
37 bottles of beer on the wall, 37 bottles of beer.
|
||||
Take one down and pass it around, 36 bottles of beer on the wall.
|
||||
|
||||
36 bottles of beer on the wall, 36 bottles of beer.
|
||||
Take one down and pass it around, 35 bottles of beer on the wall.
|
||||
|
||||
35 bottles of beer on the wall, 35 bottles of beer.
|
||||
Take one down and pass it around, 34 bottles of beer on the wall.
|
||||
|
||||
34 bottles of beer on the wall, 34 bottles of beer.
|
||||
Take one down and pass it around, 33 bottles of beer on the wall.
|
||||
|
||||
33 bottles of beer on the wall, 33 bottles of beer.
|
||||
Take one down and pass it around, 32 bottles of beer on the wall.
|
||||
|
||||
32 bottles of beer on the wall, 32 bottles of beer.
|
||||
Take one down and pass it around, 31 bottles of beer on the wall.
|
||||
|
||||
31 bottles of beer on the wall, 31 bottles of beer.
|
||||
Take one down and pass it around, 30 bottles of beer on the wall.
|
||||
|
||||
30 bottles of beer on the wall, 30 bottles of beer.
|
||||
Take one down and pass it around, 29 bottles of beer on the wall.
|
||||
|
||||
29 bottles of beer on the wall, 29 bottles of beer.
|
||||
Take one down and pass it around, 28 bottles of beer on the wall.
|
||||
|
||||
28 bottles of beer on the wall, 28 bottles of beer.
|
||||
Take one down and pass it around, 27 bottles of beer on the wall.
|
||||
|
||||
27 bottles of beer on the wall, 27 bottles of beer.
|
||||
Take one down and pass it around, 26 bottles of beer on the wall.
|
||||
|
||||
26 bottles of beer on the wall, 26 bottles of beer.
|
||||
Take one down and pass it around, 25 bottles of beer on the wall.
|
||||
|
||||
25 bottles of beer on the wall, 25 bottles of beer.
|
||||
Take one down and pass it around, 24 bottles of beer on the wall.
|
||||
|
||||
24 bottles of beer on the wall, 24 bottles of beer.
|
||||
Take one down and pass it around, 23 bottles of beer on the wall.
|
||||
|
||||
23 bottles of beer on the wall, 23 bottles of beer.
|
||||
Take one down and pass it around, 22 bottles of beer on the wall.
|
||||
|
||||
22 bottles of beer on the wall, 22 bottles of beer.
|
||||
Take one down and pass it around, 21 bottles of beer on the wall.
|
||||
|
||||
21 bottles of beer on the wall, 21 bottles of beer.
|
||||
Take one down and pass it around, 20 bottles of beer on the wall.
|
||||
|
||||
20 bottles of beer on the wall, 20 bottles of beer.
|
||||
Take one down and pass it around, 19 bottles of beer on the wall.
|
||||
|
||||
19 bottles of beer on the wall, 19 bottles of beer.
|
||||
Take one down and pass it around, 18 bottles of beer on the wall.
|
||||
|
||||
18 bottles of beer on the wall, 18 bottles of beer.
|
||||
Take one down and pass it around, 17 bottles of beer on the wall.
|
||||
|
||||
17 bottles of beer on the wall, 17 bottles of beer.
|
||||
Take one down and pass it around, 16 bottles of beer on the wall.
|
||||
|
||||
16 bottles of beer on the wall, 16 bottles of beer.
|
||||
Take one down and pass it around, 15 bottles of beer on the wall.
|
||||
|
||||
15 bottles of beer on the wall, 15 bottles of beer.
|
||||
Take one down and pass it around, 14 bottles of beer on the wall.
|
||||
|
||||
14 bottles of beer on the wall, 14 bottles of beer.
|
||||
Take one down and pass it around, 13 bottles of beer on the wall.
|
||||
|
||||
13 bottles of beer on the wall, 13 bottles of beer.
|
||||
Take one down and pass it around, 12 bottles of beer on the wall.
|
||||
|
||||
12 bottles of beer on the wall, 12 bottles of beer.
|
||||
Take one down and pass it around, 11 bottles of beer on the wall.
|
||||
|
||||
11 bottles of beer on the wall, 11 bottles of beer.
|
||||
Take one down and pass it around, 10 bottles of beer on the wall.
|
||||
|
||||
10 bottles of beer on the wall, 10 bottles of beer.
|
||||
Take one down and pass it around, 9 bottles of beer on the wall.
|
||||
|
||||
9 bottles of beer on the wall, 9 bottles of beer.
|
||||
Take one down and pass it around, 8 bottles of beer on the wall.
|
||||
|
||||
8 bottles of beer on the wall, 8 bottles of beer.
|
||||
Take one down and pass it around, 7 bottles of beer on the wall.
|
||||
|
||||
7 bottles of beer on the wall, 7 bottles of beer.
|
||||
Take one down and pass it around, 6 bottles of beer on the wall.
|
||||
|
||||
6 bottles of beer on the wall, 6 bottles of beer.
|
||||
Take one down and pass it around, 5 bottles of beer on the wall.
|
||||
|
||||
5 bottles of beer on the wall, 5 bottles of beer.
|
||||
Take one down and pass it around, 4 bottles of beer on the wall.
|
||||
|
||||
4 bottles of beer on the wall, 4 bottles of beer.
|
||||
Take one down and pass it around, 3 bottles of beer on the wall.
|
||||
|
||||
3 bottles of beer on the wall, 3 bottles of beer.
|
||||
Take one down and pass it around, 2 bottles of beer on the wall.
|
||||
|
||||
2 bottles of beer on the wall, 2 bottles of beer.
|
||||
Take one down and pass it around, 1 bottle of beer on the wall.
|
||||
|
||||
1 bottle of beer on the wall, 1 bottle of beer.
|
||||
Take it down and pass it around, no more bottles of beer on the wall.
|
||||
|
||||
No more bottles of beer on the wall, no more bottles of beer.
|
||||
Go to the store and buy some more, 99 bottles of beer on the wall.
|
||||
```
|
||||
|
||||
## For bonus points
|
||||
|
||||
Did you get the tests passing and the code clean? If you want to, these
|
||||
are some additional things you could try:
|
||||
|
||||
* Remove as much duplication as you possibly can.
|
||||
* Optimize for readability, even if it means introducing duplication.
|
||||
* If you've removed all the duplication, do you have a lot of
|
||||
conditionals? Try replacing the conditionals with polymorphism, if it
|
||||
applies in this language. How readable is it?
|
||||
|
||||
Then please share your thoughts in a comment on the submission. Did this
|
||||
experiment make the code better? Worse? Did you learn anything from it?
|
||||
|
||||
## Source
|
||||
|
||||
Learn to Program by Chris Pine [http://pine.fm/LearnToProgram/?Chapter=06](http://pine.fm/LearnToProgram/?Chapter=06)
|
||||
|
||||
## Submitting Incomplete Solutions
|
||||
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||
|
||||
12
kotlin/beer-song/beer-song.iml
Normal file
12
kotlin/beer-song/beer-song.iml
Normal file
|
|
@ -0,0 +1,12 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="beer-song" external.linked.project.path="$MODULE_DIR$" external.root.project.path="$MODULE_DIR$" external.system.id="GRADLE" external.system.module.group="" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="NewModuleRootManager" inherit-compiler-output="true">
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$">
|
||||
<excludeFolder url="file://$MODULE_DIR$/.gradle" />
|
||||
<excludeFolder url="file://$MODULE_DIR$/build" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
</component>
|
||||
</module>
|
||||
28
kotlin/beer-song/build.gradle
Normal file
28
kotlin/beer-song/build.gradle
Normal file
|
|
@ -0,0 +1,28 @@
|
|||
buildscript {
|
||||
ext.kotlin_version = '1.1.1'
|
||||
repositories {
|
||||
mavenCentral()
|
||||
}
|
||||
dependencies {
|
||||
classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version"
|
||||
}
|
||||
}
|
||||
|
||||
apply plugin: 'kotlin'
|
||||
|
||||
repositories {
|
||||
mavenCentral()
|
||||
}
|
||||
|
||||
dependencies {
|
||||
compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version"
|
||||
|
||||
testCompile 'junit:junit:4.12'
|
||||
testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version"
|
||||
}
|
||||
test {
|
||||
testLogging {
|
||||
exceptionFormat = 'full'
|
||||
events = ["passed", "failed", "skipped"]
|
||||
}
|
||||
}
|
||||
BIN
kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class
Normal file
BIN
kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class
Normal file
Binary file not shown.
BIN
kotlin/beer-song/build/classes/main/BeerSong.class
Normal file
BIN
kotlin/beer-song/build/classes/main/BeerSong.class
Normal file
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
BIN
kotlin/beer-song/build/classes/test/BeerSongTest.class
Normal file
BIN
kotlin/beer-song/build/classes/test/BeerSongTest.class
Normal file
Binary file not shown.
1
kotlin/beer-song/build/kotlin-build/caches/version.txt
Normal file
1
kotlin/beer-song/build/kotlin-build/caches/version.txt
Normal file
|
|
@ -0,0 +1 @@
|
|||
11001
|
||||
0
kotlin/beer-song/src/main/kotlin/.keep
Normal file
0
kotlin/beer-song/src/main/kotlin/.keep
Normal file
18
kotlin/beer-song/src/main/kotlin/BeerSong.kt
Normal file
18
kotlin/beer-song/src/main/kotlin/BeerSong.kt
Normal file
|
|
@ -0,0 +1,18 @@
|
|||
object BeerSong {
|
||||
val lyrics: String by lazy {
|
||||
verses(99, 0)
|
||||
}
|
||||
fun verse(verseNumber: Int): String{
|
||||
if (verseNumber < 0 || verseNumber > 99) throw IllegalArgumentException()
|
||||
when (verseNumber){
|
||||
0 -> return "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
|
||||
1 -> return "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n"
|
||||
2 -> return "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n"
|
||||
else -> return "${verseNumber} bottles of beer on the wall, ${verseNumber} bottles of beer.\nTake one down and pass it around, ${verseNumber -1} bottles of beer on the wall.\n"
|
||||
}
|
||||
}
|
||||
|
||||
fun verses(firstVerse: Int, lastVerse: Int): String{
|
||||
return (IntRange(lastVerse, firstVerse).reversed()).map { verse(it) }.fold("", {acc, s -> acc + s + "\n" }).dropLast(1)
|
||||
}
|
||||
}
|
||||
386
kotlin/beer-song/src/test/kotlin/BeerSongTest.kt
Normal file
386
kotlin/beer-song/src/test/kotlin/BeerSongTest.kt
Normal file
|
|
@ -0,0 +1,386 @@
|
|||
import org.junit.Test
|
||||
import org.junit.Ignore
|
||||
import kotlin.test.assertEquals
|
||||
import kotlin.test.assertFailsWith
|
||||
|
||||
class BeerSongTest {
|
||||
|
||||
|
||||
@Test
|
||||
fun verse0() {
|
||||
val expected = "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verse(0))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verse1() {
|
||||
val expected = "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verse(1))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verse2() {
|
||||
val expected = "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verse(2))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verse8() {
|
||||
val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verse(8))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verse99() {
|
||||
val expected = "99 bottles of beer on the wall, 99 bottles of beer.\nTake one down and pass it around, 98 bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verse(99))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verseMinus1() {
|
||||
assertFailsWith(IllegalArgumentException::class, "Beer song verse can't be negative", { BeerSong.verse(-1) })
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun verse100() {
|
||||
assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verse(100) })
|
||||
}
|
||||
|
||||
@Test
|
||||
fun songVerse8To6() {
|
||||
val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n\n7 bottles of beer on the wall, 7 bottles of beer.\nTake one down and pass it around, 6 bottles of beer on the wall.\n\n6 bottles of beer on the wall, 6 bottles of beer.\nTake one down and pass it around, 5 bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verses(8, 6))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun songVerse3To0() {
|
||||
val expected = "3 bottles of beer on the wall, 3 bottles of beer.\nTake one down and pass it around, 2 bottles of beer on the wall.\n\n2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n\n1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n\nNo more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
|
||||
assertEquals(expected, BeerSong.verses(3, 0))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun songVerse100To98() {
|
||||
assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verses(100, 98) })
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun songVerse3ToMinus1() {
|
||||
assertFailsWith(IllegalArgumentException::class, "Beer song can't go down into a negative verse", { BeerSong.verses(3, -1) })
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun entireSong() {
|
||||
val expected =
|
||||
"""99 bottles of beer on the wall, 99 bottles of beer.
|
||||
Take one down and pass it around, 98 bottles of beer on the wall.
|
||||
|
||||
98 bottles of beer on the wall, 98 bottles of beer.
|
||||
Take one down and pass it around, 97 bottles of beer on the wall.
|
||||
|
||||
97 bottles of beer on the wall, 97 bottles of beer.
|
||||
Take one down and pass it around, 96 bottles of beer on the wall.
|
||||
|
||||
96 bottles of beer on the wall, 96 bottles of beer.
|
||||
Take one down and pass it around, 95 bottles of beer on the wall.
|
||||
|
||||
95 bottles of beer on the wall, 95 bottles of beer.
|
||||
Take one down and pass it around, 94 bottles of beer on the wall.
|
||||
|
||||
94 bottles of beer on the wall, 94 bottles of beer.
|
||||
Take one down and pass it around, 93 bottles of beer on the wall.
|
||||
|
||||
93 bottles of beer on the wall, 93 bottles of beer.
|
||||
Take one down and pass it around, 92 bottles of beer on the wall.
|
||||
|
||||
92 bottles of beer on the wall, 92 bottles of beer.
|
||||
Take one down and pass it around, 91 bottles of beer on the wall.
|
||||
|
||||
91 bottles of beer on the wall, 91 bottles of beer.
|
||||
Take one down and pass it around, 90 bottles of beer on the wall.
|
||||
|
||||
90 bottles of beer on the wall, 90 bottles of beer.
|
||||
Take one down and pass it around, 89 bottles of beer on the wall.
|
||||
|
||||
89 bottles of beer on the wall, 89 bottles of beer.
|
||||
Take one down and pass it around, 88 bottles of beer on the wall.
|
||||
|
||||
88 bottles of beer on the wall, 88 bottles of beer.
|
||||
Take one down and pass it around, 87 bottles of beer on the wall.
|
||||
|
||||
87 bottles of beer on the wall, 87 bottles of beer.
|
||||
Take one down and pass it around, 86 bottles of beer on the wall.
|
||||
|
||||
86 bottles of beer on the wall, 86 bottles of beer.
|
||||
Take one down and pass it around, 85 bottles of beer on the wall.
|
||||
|
||||
85 bottles of beer on the wall, 85 bottles of beer.
|
||||
Take one down and pass it around, 84 bottles of beer on the wall.
|
||||
|
||||
84 bottles of beer on the wall, 84 bottles of beer.
|
||||
Take one down and pass it around, 83 bottles of beer on the wall.
|
||||
|
||||
83 bottles of beer on the wall, 83 bottles of beer.
|
||||
Take one down and pass it around, 82 bottles of beer on the wall.
|
||||
|
||||
82 bottles of beer on the wall, 82 bottles of beer.
|
||||
Take one down and pass it around, 81 bottles of beer on the wall.
|
||||
|
||||
81 bottles of beer on the wall, 81 bottles of beer.
|
||||
Take one down and pass it around, 80 bottles of beer on the wall.
|
||||
|
||||
80 bottles of beer on the wall, 80 bottles of beer.
|
||||
Take one down and pass it around, 79 bottles of beer on the wall.
|
||||
|
||||
79 bottles of beer on the wall, 79 bottles of beer.
|
||||
Take one down and pass it around, 78 bottles of beer on the wall.
|
||||
|
||||
78 bottles of beer on the wall, 78 bottles of beer.
|
||||
Take one down and pass it around, 77 bottles of beer on the wall.
|
||||
|
||||
77 bottles of beer on the wall, 77 bottles of beer.
|
||||
Take one down and pass it around, 76 bottles of beer on the wall.
|
||||
|
||||
76 bottles of beer on the wall, 76 bottles of beer.
|
||||
Take one down and pass it around, 75 bottles of beer on the wall.
|
||||
|
||||
75 bottles of beer on the wall, 75 bottles of beer.
|
||||
Take one down and pass it around, 74 bottles of beer on the wall.
|
||||
|
||||
74 bottles of beer on the wall, 74 bottles of beer.
|
||||
Take one down and pass it around, 73 bottles of beer on the wall.
|
||||
|
||||
73 bottles of beer on the wall, 73 bottles of beer.
|
||||
Take one down and pass it around, 72 bottles of beer on the wall.
|
||||
|
||||
72 bottles of beer on the wall, 72 bottles of beer.
|
||||
Take one down and pass it around, 71 bottles of beer on the wall.
|
||||
|
||||
71 bottles of beer on the wall, 71 bottles of beer.
|
||||
Take one down and pass it around, 70 bottles of beer on the wall.
|
||||
|
||||
70 bottles of beer on the wall, 70 bottles of beer.
|
||||
Take one down and pass it around, 69 bottles of beer on the wall.
|
||||
|
||||
69 bottles of beer on the wall, 69 bottles of beer.
|
||||
Take one down and pass it around, 68 bottles of beer on the wall.
|
||||
|
||||
68 bottles of beer on the wall, 68 bottles of beer.
|
||||
Take one down and pass it around, 67 bottles of beer on the wall.
|
||||
|
||||
67 bottles of beer on the wall, 67 bottles of beer.
|
||||
Take one down and pass it around, 66 bottles of beer on the wall.
|
||||
|
||||
66 bottles of beer on the wall, 66 bottles of beer.
|
||||
Take one down and pass it around, 65 bottles of beer on the wall.
|
||||
|
||||
65 bottles of beer on the wall, 65 bottles of beer.
|
||||
Take one down and pass it around, 64 bottles of beer on the wall.
|
||||
|
||||
64 bottles of beer on the wall, 64 bottles of beer.
|
||||
Take one down and pass it around, 63 bottles of beer on the wall.
|
||||
|
||||
63 bottles of beer on the wall, 63 bottles of beer.
|
||||
Take one down and pass it around, 62 bottles of beer on the wall.
|
||||
|
||||
62 bottles of beer on the wall, 62 bottles of beer.
|
||||
Take one down and pass it around, 61 bottles of beer on the wall.
|
||||
|
||||
61 bottles of beer on the wall, 61 bottles of beer.
|
||||
Take one down and pass it around, 60 bottles of beer on the wall.
|
||||
|
||||
60 bottles of beer on the wall, 60 bottles of beer.
|
||||
Take one down and pass it around, 59 bottles of beer on the wall.
|
||||
|
||||
59 bottles of beer on the wall, 59 bottles of beer.
|
||||
Take one down and pass it around, 58 bottles of beer on the wall.
|
||||
|
||||
58 bottles of beer on the wall, 58 bottles of beer.
|
||||
Take one down and pass it around, 57 bottles of beer on the wall.
|
||||
|
||||
57 bottles of beer on the wall, 57 bottles of beer.
|
||||
Take one down and pass it around, 56 bottles of beer on the wall.
|
||||
|
||||
56 bottles of beer on the wall, 56 bottles of beer.
|
||||
Take one down and pass it around, 55 bottles of beer on the wall.
|
||||
|
||||
55 bottles of beer on the wall, 55 bottles of beer.
|
||||
Take one down and pass it around, 54 bottles of beer on the wall.
|
||||
|
||||
54 bottles of beer on the wall, 54 bottles of beer.
|
||||
Take one down and pass it around, 53 bottles of beer on the wall.
|
||||
|
||||
53 bottles of beer on the wall, 53 bottles of beer.
|
||||
Take one down and pass it around, 52 bottles of beer on the wall.
|
||||
|
||||
52 bottles of beer on the wall, 52 bottles of beer.
|
||||
Take one down and pass it around, 51 bottles of beer on the wall.
|
||||
|
||||
51 bottles of beer on the wall, 51 bottles of beer.
|
||||
Take one down and pass it around, 50 bottles of beer on the wall.
|
||||
|
||||
50 bottles of beer on the wall, 50 bottles of beer.
|
||||
Take one down and pass it around, 49 bottles of beer on the wall.
|
||||
|
||||
49 bottles of beer on the wall, 49 bottles of beer.
|
||||
Take one down and pass it around, 48 bottles of beer on the wall.
|
||||
|
||||
48 bottles of beer on the wall, 48 bottles of beer.
|
||||
Take one down and pass it around, 47 bottles of beer on the wall.
|
||||
|
||||
47 bottles of beer on the wall, 47 bottles of beer.
|
||||
Take one down and pass it around, 46 bottles of beer on the wall.
|
||||
|
||||
46 bottles of beer on the wall, 46 bottles of beer.
|
||||
Take one down and pass it around, 45 bottles of beer on the wall.
|
||||
|
||||
45 bottles of beer on the wall, 45 bottles of beer.
|
||||
Take one down and pass it around, 44 bottles of beer on the wall.
|
||||
|
||||
44 bottles of beer on the wall, 44 bottles of beer.
|
||||
Take one down and pass it around, 43 bottles of beer on the wall.
|
||||
|
||||
43 bottles of beer on the wall, 43 bottles of beer.
|
||||
Take one down and pass it around, 42 bottles of beer on the wall.
|
||||
|
||||
42 bottles of beer on the wall, 42 bottles of beer.
|
||||
Take one down and pass it around, 41 bottles of beer on the wall.
|
||||
|
||||
41 bottles of beer on the wall, 41 bottles of beer.
|
||||
Take one down and pass it around, 40 bottles of beer on the wall.
|
||||
|
||||
40 bottles of beer on the wall, 40 bottles of beer.
|
||||
Take one down and pass it around, 39 bottles of beer on the wall.
|
||||
|
||||
39 bottles of beer on the wall, 39 bottles of beer.
|
||||
Take one down and pass it around, 38 bottles of beer on the wall.
|
||||
|
||||
38 bottles of beer on the wall, 38 bottles of beer.
|
||||
Take one down and pass it around, 37 bottles of beer on the wall.
|
||||
|
||||
37 bottles of beer on the wall, 37 bottles of beer.
|
||||
Take one down and pass it around, 36 bottles of beer on the wall.
|
||||
|
||||
36 bottles of beer on the wall, 36 bottles of beer.
|
||||
Take one down and pass it around, 35 bottles of beer on the wall.
|
||||
|
||||
35 bottles of beer on the wall, 35 bottles of beer.
|
||||
Take one down and pass it around, 34 bottles of beer on the wall.
|
||||
|
||||
34 bottles of beer on the wall, 34 bottles of beer.
|
||||
Take one down and pass it around, 33 bottles of beer on the wall.
|
||||
|
||||
33 bottles of beer on the wall, 33 bottles of beer.
|
||||
Take one down and pass it around, 32 bottles of beer on the wall.
|
||||
|
||||
32 bottles of beer on the wall, 32 bottles of beer.
|
||||
Take one down and pass it around, 31 bottles of beer on the wall.
|
||||
|
||||
31 bottles of beer on the wall, 31 bottles of beer.
|
||||
Take one down and pass it around, 30 bottles of beer on the wall.
|
||||
|
||||
30 bottles of beer on the wall, 30 bottles of beer.
|
||||
Take one down and pass it around, 29 bottles of beer on the wall.
|
||||
|
||||
29 bottles of beer on the wall, 29 bottles of beer.
|
||||
Take one down and pass it around, 28 bottles of beer on the wall.
|
||||
|
||||
28 bottles of beer on the wall, 28 bottles of beer.
|
||||
Take one down and pass it around, 27 bottles of beer on the wall.
|
||||
|
||||
27 bottles of beer on the wall, 27 bottles of beer.
|
||||
Take one down and pass it around, 26 bottles of beer on the wall.
|
||||
|
||||
26 bottles of beer on the wall, 26 bottles of beer.
|
||||
Take one down and pass it around, 25 bottles of beer on the wall.
|
||||
|
||||
25 bottles of beer on the wall, 25 bottles of beer.
|
||||
Take one down and pass it around, 24 bottles of beer on the wall.
|
||||
|
||||
24 bottles of beer on the wall, 24 bottles of beer.
|
||||
Take one down and pass it around, 23 bottles of beer on the wall.
|
||||
|
||||
23 bottles of beer on the wall, 23 bottles of beer.
|
||||
Take one down and pass it around, 22 bottles of beer on the wall.
|
||||
|
||||
22 bottles of beer on the wall, 22 bottles of beer.
|
||||
Take one down and pass it around, 21 bottles of beer on the wall.
|
||||
|
||||
21 bottles of beer on the wall, 21 bottles of beer.
|
||||
Take one down and pass it around, 20 bottles of beer on the wall.
|
||||
|
||||
20 bottles of beer on the wall, 20 bottles of beer.
|
||||
Take one down and pass it around, 19 bottles of beer on the wall.
|
||||
|
||||
19 bottles of beer on the wall, 19 bottles of beer.
|
||||
Take one down and pass it around, 18 bottles of beer on the wall.
|
||||
|
||||
18 bottles of beer on the wall, 18 bottles of beer.
|
||||
Take one down and pass it around, 17 bottles of beer on the wall.
|
||||
|
||||
17 bottles of beer on the wall, 17 bottles of beer.
|
||||
Take one down and pass it around, 16 bottles of beer on the wall.
|
||||
|
||||
16 bottles of beer on the wall, 16 bottles of beer.
|
||||
Take one down and pass it around, 15 bottles of beer on the wall.
|
||||
|
||||
15 bottles of beer on the wall, 15 bottles of beer.
|
||||
Take one down and pass it around, 14 bottles of beer on the wall.
|
||||
|
||||
14 bottles of beer on the wall, 14 bottles of beer.
|
||||
Take one down and pass it around, 13 bottles of beer on the wall.
|
||||
|
||||
13 bottles of beer on the wall, 13 bottles of beer.
|
||||
Take one down and pass it around, 12 bottles of beer on the wall.
|
||||
|
||||
12 bottles of beer on the wall, 12 bottles of beer.
|
||||
Take one down and pass it around, 11 bottles of beer on the wall.
|
||||
|
||||
11 bottles of beer on the wall, 11 bottles of beer.
|
||||
Take one down and pass it around, 10 bottles of beer on the wall.
|
||||
|
||||
10 bottles of beer on the wall, 10 bottles of beer.
|
||||
Take one down and pass it around, 9 bottles of beer on the wall.
|
||||
|
||||
9 bottles of beer on the wall, 9 bottles of beer.
|
||||
Take one down and pass it around, 8 bottles of beer on the wall.
|
||||
|
||||
8 bottles of beer on the wall, 8 bottles of beer.
|
||||
Take one down and pass it around, 7 bottles of beer on the wall.
|
||||
|
||||
7 bottles of beer on the wall, 7 bottles of beer.
|
||||
Take one down and pass it around, 6 bottles of beer on the wall.
|
||||
|
||||
6 bottles of beer on the wall, 6 bottles of beer.
|
||||
Take one down and pass it around, 5 bottles of beer on the wall.
|
||||
|
||||
5 bottles of beer on the wall, 5 bottles of beer.
|
||||
Take one down and pass it around, 4 bottles of beer on the wall.
|
||||
|
||||
4 bottles of beer on the wall, 4 bottles of beer.
|
||||
Take one down and pass it around, 3 bottles of beer on the wall.
|
||||
|
||||
3 bottles of beer on the wall, 3 bottles of beer.
|
||||
Take one down and pass it around, 2 bottles of beer on the wall.
|
||||
|
||||
2 bottles of beer on the wall, 2 bottles of beer.
|
||||
Take one down and pass it around, 1 bottle of beer on the wall.
|
||||
|
||||
1 bottle of beer on the wall, 1 bottle of beer.
|
||||
Take it down and pass it around, no more bottles of beer on the wall.
|
||||
|
||||
No more bottles of beer on the wall, no more bottles of beer.
|
||||
Go to the store and buy some more, 99 bottles of beer on the wall.
|
||||
"""
|
||||
assertEquals(expected, BeerSong.lyrics)
|
||||
}
|
||||
}
|
||||
56
kotlin/isogram/.idea/workspace.xml
generated
56
kotlin/isogram/.idea/workspace.xml
generated
|
|
@ -35,8 +35,8 @@
|
|||
<file leaf-file-name="Isogram.kt" pinned="false" current-in-tab="true">
|
||||
<entry file="file://$PROJECT_DIR$/src/main/kotlin/Isogram.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="133">
|
||||
<caret line="7" column="1" lean-forward="true" selection-start-line="7" selection-start-column="1" selection-end-line="7" selection-end-column="1" />
|
||||
<state relative-caret-position="0">
|
||||
<caret line="0" column="49" lean-forward="false" selection-start-line="0" selection-start-column="0" selection-end-line="1" selection-end-column="0" />
|
||||
<folding />
|
||||
</state>
|
||||
</provider>
|
||||
|
|
@ -415,8 +415,6 @@
|
|||
</navigator>
|
||||
<panes>
|
||||
<pane id="Scratches" />
|
||||
<pane id="PackagesPane" />
|
||||
<pane id="Scope" />
|
||||
<pane id="ProjectPane">
|
||||
<subPane>
|
||||
<PATH>
|
||||
|
|
@ -445,11 +443,13 @@
|
|||
</PATH>
|
||||
</subPane>
|
||||
</pane>
|
||||
<pane id="PackagesPane" />
|
||||
<pane id="Scope" />
|
||||
</panes>
|
||||
</component>
|
||||
<component name="PropertiesComponent">
|
||||
<property name="WebServerToolWindowFactoryState" value="false" />
|
||||
<property name="last_opened_file_path" value="$PROJECT_DIR$/../hamming" />
|
||||
<property name="last_opened_file_path" value="$PROJECT_DIR$" />
|
||||
</component>
|
||||
<component name="PsiViewer.ProjectComponent">
|
||||
<option name="HIGHLIGHT" value="false" />
|
||||
|
|
@ -765,6 +765,19 @@
|
|||
<module name="isogram_main" />
|
||||
<method />
|
||||
</configuration>
|
||||
<configuration default="true" type="executeSpecs" factoryName="Gauge Execution">
|
||||
<setting name="environment" value="" />
|
||||
<setting name="specsToExecute" value="" />
|
||||
<setting name="tags" value="" />
|
||||
<setting name="parallelNodes" value="" />
|
||||
<setting name="execInParallel" value="false" />
|
||||
<setting name="programParameters" value="" />
|
||||
<setting name="workingDirectory" value="" />
|
||||
<setting name="moduleName" value="" />
|
||||
<envMap />
|
||||
<setting name="rowsRange" value="" />
|
||||
<method />
|
||||
</configuration>
|
||||
<configuration default="true" type="tests" factoryName="Doctests">
|
||||
<option name="INTERPRETER_OPTIONS" value="" />
|
||||
<option name="PARENT_ENVS" value="true" />
|
||||
|
|
@ -877,7 +890,7 @@
|
|||
<option name="totallyTimeSpent" value="689000" />
|
||||
</component>
|
||||
<component name="ToolWindowManager">
|
||||
<frame x="-9" y="-9" width="1938" height="1050" extended-state="6" />
|
||||
<frame x="-9" y="-9" width="1938" height="1050" extended-state="7" />
|
||||
<editor active="true" />
|
||||
<layout>
|
||||
<window_info id="Palette" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.33" sideWeight="0.5" order="3" side_tool="false" content_ui="tabs" />
|
||||
|
|
@ -926,6 +939,33 @@
|
|||
<option name="FILTER_TARGETS" value="false" />
|
||||
</component>
|
||||
<component name="editorHistoryManager">
|
||||
<entry file="file://$PROJECT_DIR$/README.md">
|
||||
<provider selected="true" editor-type-id="split-provider[text-editor;markdown-preview-editor]">
|
||||
<state split_layout="SPLIT">
|
||||
<first_editor relative-caret-position="0">
|
||||
<caret line="0" column="0" lean-forward="false" selection-start-line="0" selection-start-column="0" selection-end-line="0" selection-end-column="0" />
|
||||
<folding />
|
||||
</first_editor>
|
||||
<second_editor />
|
||||
</state>
|
||||
</provider>
|
||||
</entry>
|
||||
<entry file="file://$PROJECT_DIR$/src/test/kotlin/IsogramTest.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="475">
|
||||
<caret line="29" column="16" lean-forward="false" selection-start-line="29" selection-start-column="16" selection-end-line="29" selection-end-column="16" />
|
||||
<folding />
|
||||
</state>
|
||||
</provider>
|
||||
</entry>
|
||||
<entry file="file://$PROJECT_DIR$/src/main/kotlin/Isogram.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="133">
|
||||
<caret line="7" column="1" lean-forward="true" selection-start-line="7" selection-start-column="1" selection-end-line="7" selection-end-column="1" />
|
||||
<folding />
|
||||
</state>
|
||||
</provider>
|
||||
</entry>
|
||||
<entry file="file://$PROJECT_DIR$/README.md">
|
||||
<provider selected="true" editor-type-id="split-provider[text-editor;markdown-preview-editor]">
|
||||
<state split_layout="SPLIT">
|
||||
|
|
@ -1004,8 +1044,8 @@
|
|||
</entry>
|
||||
<entry file="file://$PROJECT_DIR$/src/main/kotlin/Isogram.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="133">
|
||||
<caret line="7" column="1" lean-forward="true" selection-start-line="7" selection-start-column="1" selection-end-line="7" selection-end-column="1" />
|
||||
<state relative-caret-position="0">
|
||||
<caret line="0" column="49" lean-forward="false" selection-start-line="0" selection-start-column="0" selection-end-line="1" selection-end-column="0" />
|
||||
<folding />
|
||||
</state>
|
||||
</provider>
|
||||
|
|
|
|||
BIN
kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin
Normal file
BIN
kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin
Normal file
Binary file not shown.
BIN
kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock
Normal file
BIN
kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock
Normal file
Binary file not shown.
|
|
@ -0,0 +1,2 @@
|
|||
#Mon Jun 05 13:06:39 EDT 2017
|
||||
gradle.version=3.5
|
||||
|
|
@ -0,0 +1 @@
|
|||
|
||||
9
kotlin/nucleotide-count/.idea/compiler.xml
generated
Normal file
9
kotlin/nucleotide-count/.idea/compiler.xml
generated
Normal file
|
|
@ -0,0 +1,9 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="CompilerConfiguration">
|
||||
<bytecodeTargetLevel>
|
||||
<module name="nucleotide-count_main" target="1.8" />
|
||||
<module name="nucleotide-count_test" target="1.8" />
|
||||
</bytecodeTargetLevel>
|
||||
</component>
|
||||
</project>
|
||||
19
kotlin/nucleotide-count/.idea/gradle.xml
generated
Normal file
19
kotlin/nucleotide-count/.idea/gradle.xml
generated
Normal file
|
|
@ -0,0 +1,19 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="GradleSettings">
|
||||
<option name="linkedExternalProjectsSettings">
|
||||
<GradleProjectSettings>
|
||||
<option name="distributionType" value="LOCAL" />
|
||||
<option name="externalProjectPath" value="$PROJECT_DIR$" />
|
||||
<option name="gradleHome" value="C:/Gradle/gradle-3.5" />
|
||||
<option name="gradleJvm" value="#JAVA_HOME" />
|
||||
<option name="modules">
|
||||
<set>
|
||||
<option value="$PROJECT_DIR$" />
|
||||
</set>
|
||||
</option>
|
||||
<option name="useAutoImport" value="true" />
|
||||
</GradleProjectSettings>
|
||||
</option>
|
||||
</component>
|
||||
</project>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: junit:junit:4.12">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/junit/junit/4.12/2973d150c0dc1fefe998f834810d68f278ea58ec/junit-4.12.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/junit/junit/4.12/a6c32b40bf3d76eca54e3c601e5d1470c86fcdfa/junit-4.12-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.hamcrest:hamcrest-core:1.3">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.hamcrest/hamcrest-core/1.3/42a25dc3219429f0e5d060061f71acb49bf010a0/hamcrest-core-1.3.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.hamcrest/hamcrest-core/1.3/1dc37250fbc78e23a65a67fbbaf71d2e9cbc3c0b/hamcrest-core-1.3-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains:annotations:13.0">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains/annotations/13.0/919f0dfe192fb4e063e7dacadee7f8bb9a2672a9/annotations-13.0.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains/annotations/13.0/5991ca87ef1fb5544943d9abc5a9a37583fabe03/annotations-13.0-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-stdlib/1.1.1/98e484e67f913e934559f7f55f0c94be5593f03c/kotlin-stdlib-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-stdlib/1.1.1/a287944d92875a1f3c2161e5cddaede7720913d1/kotlin-stdlib-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-test:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test/1.1.1/5a852a554eb4f9fb93efdffa352b7983ed595e32/kotlin-test-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test/1.1.1/4b9a869f86569edea4a07d19b9749ac835fb7207/kotlin-test-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
generated
Normal file
11
kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
generated
Normal file
|
|
@ -0,0 +1,11 @@
|
|||
<component name="libraryTable">
|
||||
<library name="Gradle: org.jetbrains.kotlin:kotlin-test-junit:1.1.1">
|
||||
<CLASSES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test-junit/1.1.1/a1865f59b6f72597452e5bdfefeb14d13bc31c7d/kotlin-test-junit-1.1.1.jar!/" />
|
||||
</CLASSES>
|
||||
<JAVADOC />
|
||||
<SOURCES>
|
||||
<root url="jar://$USER_HOME$/.gradle/caches/modules-2/files-2.1/org.jetbrains.kotlin/kotlin-test-junit/1.1.1/ed59de63c4565c708124caaa4e86562a780f9ba0/kotlin-test-junit-1.1.1-sources.jar!/" />
|
||||
</SOURCES>
|
||||
</library>
|
||||
</component>
|
||||
22
kotlin/nucleotide-count/.idea/misc.xml
generated
Normal file
22
kotlin/nucleotide-count/.idea/misc.xml
generated
Normal file
|
|
@ -0,0 +1,22 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="ProjectRootManager" version="2" languageLevel="JDK_1_8" project-jdk-name="Java 1.8" project-jdk-type="JavaSDK">
|
||||
<output url="file://$PROJECT_DIR$/classes" />
|
||||
</component>
|
||||
<component name="masterDetails">
|
||||
<states>
|
||||
<state key="ProjectJDKs.UI">
|
||||
<settings>
|
||||
<last-edited>1.8</last-edited>
|
||||
<splitter-proportions>
|
||||
<option name="proportions">
|
||||
<list>
|
||||
<option value="0.2" />
|
||||
</list>
|
||||
</option>
|
||||
</splitter-proportions>
|
||||
</settings>
|
||||
</state>
|
||||
</states>
|
||||
</component>
|
||||
</project>
|
||||
10
kotlin/nucleotide-count/.idea/modules.xml
generated
Normal file
10
kotlin/nucleotide-count/.idea/modules.xml
generated
Normal file
|
|
@ -0,0 +1,10 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<project version="4">
|
||||
<component name="ProjectModuleManager">
|
||||
<modules>
|
||||
<module fileurl="file://$PROJECT_DIR$/.idea/modules/nucleotide-count.iml" filepath="$PROJECT_DIR$/.idea/modules/nucleotide-count.iml" />
|
||||
<module fileurl="file://$PROJECT_DIR$/.idea/modules/nucleotide-count_main.iml" filepath="$PROJECT_DIR$/.idea/modules/nucleotide-count_main.iml" group="nucleotide-count" />
|
||||
<module fileurl="file://$PROJECT_DIR$/.idea/modules/nucleotide-count_test.iml" filepath="$PROJECT_DIR$/.idea/modules/nucleotide-count_test.iml" group="nucleotide-count" />
|
||||
</modules>
|
||||
</component>
|
||||
</project>
|
||||
12
kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml
generated
Normal file
12
kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml
generated
Normal file
|
|
@ -0,0 +1,12 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="nucleotide-count" external.linked.project.path="$MODULE_DIR$/../.." external.root.project.path="$MODULE_DIR$/../.." external.system.id="GRADLE" external.system.module.group="" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="NewModuleRootManager" inherit-compiler-output="true">
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$/../..">
|
||||
<excludeFolder url="file://$MODULE_DIR$/../../.gradle" />
|
||||
<excludeFolder url="file://$MODULE_DIR$/../../build" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
</component>
|
||||
</module>
|
||||
40
kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml
generated
Normal file
40
kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml
generated
Normal file
|
|
@ -0,0 +1,40 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="nucleotide-count:main" external.linked.project.path="$MODULE_DIR$/../.." external.root.project.path="$MODULE_DIR$/../.." external.system.id="GRADLE" external.system.module.group="" external.system.module.type="sourceSet" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="FacetManager">
|
||||
<facet type="kotlin-language" name="Kotlin">
|
||||
<configuration version="2" platform="JVM 1.6" useProjectSettings="false">
|
||||
<compilerSettings />
|
||||
<compilerArguments>
|
||||
<option name="noStdlib" value="true" />
|
||||
<option name="noReflect" value="true" />
|
||||
<option name="moduleName" value="nucleotide-count_main" />
|
||||
<option name="jvmTarget" value="1.6" />
|
||||
<option name="addCompilerBuiltIns" value="true" />
|
||||
<option name="loadBuiltInsFromDependencies" value="true" />
|
||||
<option name="languageVersion" value="1.1" />
|
||||
<option name="apiVersion" value="1.1" />
|
||||
<option name="pluginClasspaths">
|
||||
<array />
|
||||
</option>
|
||||
<option name="coroutinesWarn" value="true" />
|
||||
<option name="pluginOptions">
|
||||
<array />
|
||||
</option>
|
||||
</compilerArguments>
|
||||
</configuration>
|
||||
</facet>
|
||||
</component>
|
||||
<component name="NewModuleRootManager" LANGUAGE_LEVEL="JDK_1_8">
|
||||
<output url="file://$MODULE_DIR$/../../build/classes/main" />
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$/../../src/main">
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/java" isTestSource="false" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/kotlin" isTestSource="false" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/main/resources" type="java-resource" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains:annotations:13.0" level="project" />
|
||||
</component>
|
||||
</module>
|
||||
46
kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml
generated
Normal file
46
kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml
generated
Normal file
|
|
@ -0,0 +1,46 @@
|
|||
<?xml version="1.0" encoding="UTF-8"?>
|
||||
<module external.linked.project.id="nucleotide-count:test" external.linked.project.path="$MODULE_DIR$/../.." external.root.project.path="$MODULE_DIR$/../.." external.system.id="GRADLE" external.system.module.group="" external.system.module.type="sourceSet" external.system.module.version="unspecified" type="JAVA_MODULE" version="4">
|
||||
<component name="FacetManager">
|
||||
<facet type="kotlin-language" name="Kotlin">
|
||||
<configuration version="2" platform="JVM 1.6" useProjectSettings="false">
|
||||
<compilerSettings />
|
||||
<compilerArguments>
|
||||
<option name="noStdlib" value="true" />
|
||||
<option name="noReflect" value="true" />
|
||||
<option name="moduleName" value="nucleotide-count_main" />
|
||||
<option name="jvmTarget" value="1.6" />
|
||||
<option name="addCompilerBuiltIns" value="true" />
|
||||
<option name="loadBuiltInsFromDependencies" value="true" />
|
||||
<option name="languageVersion" value="1.1" />
|
||||
<option name="apiVersion" value="1.1" />
|
||||
<option name="pluginClasspaths">
|
||||
<array />
|
||||
</option>
|
||||
<option name="coroutinesWarn" value="true" />
|
||||
<option name="pluginOptions">
|
||||
<array />
|
||||
</option>
|
||||
</compilerArguments>
|
||||
</configuration>
|
||||
</facet>
|
||||
</component>
|
||||
<component name="NewModuleRootManager" LANGUAGE_LEVEL="JDK_1_8">
|
||||
<output-test url="file://$MODULE_DIR$/../../build/classes/test" />
|
||||
<exclude-output />
|
||||
<content url="file://$MODULE_DIR$/../../src/test">
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/java" isTestSource="true" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/kotlin" isTestSource="true" />
|
||||
<sourceFolder url="file://$MODULE_DIR$/../../src/test/resources" type="java-test-resource" />
|
||||
</content>
|
||||
<orderEntry type="inheritedJdk" />
|
||||
<orderEntry type="sourceFolder" forTests="false" />
|
||||
<orderEntry type="module" module-name="nucleotide-count_main" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-stdlib:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: junit:junit:4.12" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-test-junit:1.1.1" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains:annotations:13.0" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.hamcrest:hamcrest-core:1.3" level="project" />
|
||||
<orderEntry type="library" name="Gradle: org.jetbrains.kotlin:kotlin-test:1.1.1" level="project" />
|
||||
</component>
|
||||
<component name="TestModuleProperties" production-module="nucleotide-count_main" />
|
||||
</module>
|
||||
1076
kotlin/nucleotide-count/.idea/workspace.xml
generated
Normal file
1076
kotlin/nucleotide-count/.idea/workspace.xml
generated
Normal file
File diff suppressed because it is too large
Load diff
35
kotlin/nucleotide-count/README.md
Normal file
35
kotlin/nucleotide-count/README.md
Normal file
|
|
@ -0,0 +1,35 @@
|
|||
# Nucleotide Count
|
||||
|
||||
Given a DNA string, compute how many times each nucleotide occurs in the string.
|
||||
|
||||
DNA is represented by an alphabet of the following symbols: 'A', 'C',
|
||||
'G', and 'T'.
|
||||
|
||||
Each symbol represents a nucleotide, which is a fancy name for the
|
||||
particular molecules that happen to make up a large part of DNA.
|
||||
|
||||
Shortest intro to biochemistry EVAR:
|
||||
|
||||
- twigs are to birds nests as
|
||||
- nucleotides are to DNA and RNA as
|
||||
- amino acids are to proteins as
|
||||
- sugar is to starch as
|
||||
- oh crap lipids
|
||||
|
||||
I'm not going to talk about lipids because they're crazy complex.
|
||||
|
||||
So back to nucleotides.
|
||||
|
||||
DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
|
||||
(`G`), and thymine (`T`).
|
||||
|
||||
RNA contains a slightly different set of nucleotides, but we don't care
|
||||
about that for now.
|
||||
|
||||
## Source
|
||||
|
||||
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
|
||||
|
||||
## Submitting Incomplete Solutions
|
||||
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||
|
||||
28
kotlin/nucleotide-count/build.gradle
Normal file
28
kotlin/nucleotide-count/build.gradle
Normal file
|
|
@ -0,0 +1,28 @@
|
|||
buildscript {
|
||||
ext.kotlin_version = '1.1.1'
|
||||
repositories {
|
||||
mavenCentral()
|
||||
}
|
||||
dependencies {
|
||||
classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version"
|
||||
}
|
||||
}
|
||||
|
||||
apply plugin: 'kotlin'
|
||||
|
||||
repositories {
|
||||
mavenCentral()
|
||||
}
|
||||
|
||||
dependencies {
|
||||
compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version"
|
||||
|
||||
testCompile 'junit:junit:4.12'
|
||||
testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version"
|
||||
}
|
||||
test {
|
||||
testLogging {
|
||||
exceptionFormat = 'full'
|
||||
events = ["passed", "failed", "skipped"]
|
||||
}
|
||||
}
|
||||
Binary file not shown.
BIN
kotlin/nucleotide-count/build/classes/main/DNA.class
Normal file
BIN
kotlin/nucleotide-count/build/classes/main/DNA.class
Normal file
Binary file not shown.
BIN
kotlin/nucleotide-count/build/classes/test/NucleotideTest.class
Normal file
BIN
kotlin/nucleotide-count/build/classes/test/NucleotideTest.class
Normal file
Binary file not shown.
|
|
@ -0,0 +1 @@
|
|||
11001
|
||||
0
kotlin/nucleotide-count/src/main/kotlin/.keep
Normal file
0
kotlin/nucleotide-count/src/main/kotlin/.keep
Normal file
23
kotlin/nucleotide-count/src/main/kotlin/DNA.kt
Normal file
23
kotlin/nucleotide-count/src/main/kotlin/DNA.kt
Normal file
|
|
@ -0,0 +1,23 @@
|
|||
class DNA(val nucleotides: String) {
|
||||
val nucleotideCounts: MutableMap<Char, Int> by lazy {
|
||||
for (i in nucleotides){
|
||||
print(i)
|
||||
if (!((i == 'A') or (i == 'C') or (i == 'G') or (i == 'T'))) throw IllegalArgumentException()
|
||||
}
|
||||
var tempMap: MutableMap<Char, Int> = emptyMap<Char, Int>().toMutableMap()
|
||||
tempMap.put('A', 0)
|
||||
tempMap.put('C', 0)
|
||||
tempMap.put('G', 0)
|
||||
tempMap.put('T', 0)
|
||||
|
||||
for (i in tempMap){
|
||||
tempMap.put(i.key, nucleotides.count { it == i.key })
|
||||
}
|
||||
|
||||
tempMap
|
||||
}
|
||||
|
||||
fun count(testChar: Char): Int{
|
||||
return nucleotideCounts.getOrDefault(testChar, 0)
|
||||
}
|
||||
}
|
||||
87
kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt
Normal file
87
kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt
Normal file
|
|
@ -0,0 +1,87 @@
|
|||
import org.junit.Test
|
||||
import org.junit.Ignore;
|
||||
import kotlin.test.assertEquals
|
||||
|
||||
class NucleotideTest {
|
||||
|
||||
|
||||
@Test
|
||||
fun emptyDnaStringHasNoAdenosine() {
|
||||
val dna = DNA("");
|
||||
|
||||
assertEquals(0, dna.count('A'))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun emptyDnaStringHasNoNucleotides() {
|
||||
val dna = DNA("");
|
||||
val expected = mapOf('A' to 0, 'C' to 0, 'G' to 0, 'T' to 0)
|
||||
|
||||
assertEquals(expected, dna.nucleotideCounts)
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun repetitiveCytidineGetsCounted() {
|
||||
val dna = DNA("CCCCC");
|
||||
assertEquals(5, dna.count('C'))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun repetitiveSequenceWithOnlyGuanosine() {
|
||||
val dna = DNA("GGGGGGGG");
|
||||
val expected = mapOf('A' to 0, 'C' to 0, 'G' to 8, 'T' to 0)
|
||||
|
||||
assertEquals(expected, dna.nucleotideCounts)
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun countsOnlyThymidine() {
|
||||
val dna = DNA("GGGGGTAACCCGG");
|
||||
|
||||
assertEquals(1, dna.count('T'))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun countsANucleotideOnlyOnce() {
|
||||
val dna = DNA("CGATTGGG");
|
||||
|
||||
dna.count('T')
|
||||
assertEquals(2, dna.count('T'))
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun dnaCountsDoNotChangeAfterCountingAdenosine() {
|
||||
val dna = DNA("GATTACA");
|
||||
val expected = mapOf('A' to 3, 'C' to 1, 'G' to 1, 'T' to 2)
|
||||
|
||||
dna.count('A');
|
||||
assertEquals(expected, dna.nucleotideCounts)
|
||||
}
|
||||
|
||||
|
||||
@Test(expected = IllegalArgumentException::class)
|
||||
fun validatesNucleotides() {
|
||||
DNA("GX")
|
||||
}
|
||||
|
||||
|
||||
@Test(expected = IllegalArgumentException::class)
|
||||
fun validatesNucleotidesCountInput() {
|
||||
DNA("GACT").count('X');
|
||||
}
|
||||
|
||||
|
||||
@Test
|
||||
fun countsAllNucleotides() {
|
||||
val dna = DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
|
||||
val expected = mapOf('A' to 20, 'C' to 12, 'G' to 17, 'T' to 21)
|
||||
|
||||
assertEquals(expected, dna.nucleotideCounts)
|
||||
}
|
||||
}
|
||||
8
kotlin/space-age/.idea/workspace.xml
generated
8
kotlin/space-age/.idea/workspace.xml
generated
|
|
@ -35,7 +35,7 @@
|
|||
<file leaf-file-name="SpaceAge.kt" pinned="false" current-in-tab="true">
|
||||
<entry file="file://$PROJECT_DIR$/src/main/kotlin/SpaceAge.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="323">
|
||||
<state relative-caret-position="400">
|
||||
<caret line="23" column="44" lean-forward="false" selection-start-line="23" selection-start-column="44" selection-end-line="23" selection-end-column="44" />
|
||||
<folding />
|
||||
</state>
|
||||
|
|
@ -484,7 +484,7 @@
|
|||
</panes>
|
||||
</component>
|
||||
<component name="PropertiesComponent">
|
||||
<property name="last_opened_file_path" value="$PROJECT_DIR$" />
|
||||
<property name="last_opened_file_path" value="$PROJECT_DIR$/../beer-song" />
|
||||
</component>
|
||||
<component name="PsiViewer.ProjectComponent">
|
||||
<option name="HIGHLIGHT" value="false" />
|
||||
|
|
@ -934,7 +934,7 @@
|
|||
<window_info id="Image Layers" active="false" anchor="left" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.33" sideWeight="0.5" order="-1" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Capture Analysis" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.33" sideWeight="0.5" order="-1" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="PsiViewer" active="false" anchor="right" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.33" sideWeight="0.5" order="-1" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Run" active="true" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="true" show_stripe_button="true" weight="0.32896176" sideWeight="0.5" order="2" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Run" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.32896176" sideWeight="0.5" order="2" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Version Control" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="false" weight="0.33" sideWeight="0.5" order="-1" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Terminal" active="false" anchor="bottom" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="false" show_stripe_button="true" weight="0.33" sideWeight="0.5" order="-1" side_tool="false" content_ui="tabs" />
|
||||
<window_info id="Project" active="false" anchor="left" auto_hide="false" internal_type="DOCKED" type="DOCKED" visible="true" show_stripe_button="true" weight="0.25" sideWeight="0.5" order="0" side_tool="false" content_ui="combo" />
|
||||
|
|
@ -982,7 +982,7 @@
|
|||
</entry>
|
||||
<entry file="file://$PROJECT_DIR$/src/main/kotlin/SpaceAge.kt">
|
||||
<provider selected="true" editor-type-id="text-editor">
|
||||
<state relative-caret-position="323">
|
||||
<state relative-caret-position="400">
|
||||
<caret line="23" column="44" lean-forward="false" selection-start-line="23" selection-start-column="44" selection-end-line="23" selection-end-column="44" />
|
||||
<folding />
|
||||
</state>
|
||||
|
|
|
|||
Loading…
Add table
Reference in a new issue