From 75d31918b9f508095fa7da841519aed500b3b68a Mon Sep 17 00:00:00 2001 From: "anthony.cicchetti" Date: Mon, 5 Jun 2017 15:04:30 -0400 Subject: [PATCH] Kotlin - Nucleotide Count WIP --- .../.gradle/3.5/file-changes/last-build.bin | Bin 0 -> 1 bytes .../.gradle/3.5/taskHistory/taskHistory.lock | Bin 0 -> 17 bytes .../.gradle/buildOutputCleanup/built.bin | 0 .../buildOutputCleanup/cache.properties | 2 + .../buildOutputCleanup/cache.properties.lock | 1 + kotlin/beer-song/.idea/compiler.xml | 9 + kotlin/beer-song/.idea/gradle.xml | 19 + .../libraries/Gradle__junit_junit_4_12.xml | 11 + ...Gradle__org_hamcrest_hamcrest_core_1_3.xml | 11 + ...Gradle__org_jetbrains_annotations_13_0.xml | 11 + ...g_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml | 11 + ...org_jetbrains_kotlin_kotlin_test_1_1_1.xml | 11 + ...tbrains_kotlin_kotlin_test_junit_1_1_1.xml | 11 + kotlin/beer-song/.idea/misc.xml | 22 + kotlin/beer-song/.idea/modules.xml | 10 + .../.idea/modules/beer-song_main.iml | 40 + .../.idea/modules/beer-song_test.iml | 46 + kotlin/beer-song/.idea/workspace.xml | 1030 ++++++++++++++++ kotlin/beer-song/README.md | 329 +++++ kotlin/beer-song/beer-song.iml | 12 + kotlin/beer-song/build.gradle | 28 + .../classes/main/BeerSong$lyrics$2.class | Bin 0 -> 1082 bytes .../build/classes/main/BeerSong.class | Bin 0 -> 4707 bytes .../BeerSongTest$songVerse100To98$1.class | Bin 0 -> 1096 bytes .../BeerSongTest$songVerse3ToMinus1$1.class | Bin 0 -> 1100 bytes .../test/BeerSongTest$verse100$1.class | Bin 0 -> 1068 bytes .../test/BeerSongTest$verseMinus1$1.class | Bin 0 -> 1076 bytes .../build/classes/test/BeerSongTest.class | Bin 0 -> 16540 bytes .../build/kotlin-build/caches/version.txt | 1 + kotlin/beer-song/src/main/kotlin/.keep | 0 kotlin/beer-song/src/main/kotlin/BeerSong.kt | 18 + .../beer-song/src/test/kotlin/BeerSongTest.kt | 386 ++++++ kotlin/isogram/.idea/workspace.xml | 56 +- .../.gradle/3.5/file-changes/last-build.bin | Bin 0 -> 1 bytes .../.gradle/3.5/taskHistory/taskHistory.lock | Bin 0 -> 17 bytes .../.gradle/buildOutputCleanup/built.bin | 0 .../buildOutputCleanup/cache.properties | 2 + .../buildOutputCleanup/cache.properties.lock | 1 + kotlin/nucleotide-count/.idea/compiler.xml | 9 + kotlin/nucleotide-count/.idea/gradle.xml | 19 + .../libraries/Gradle__junit_junit_4_12.xml | 11 + ...Gradle__org_hamcrest_hamcrest_core_1_3.xml | 11 + ...Gradle__org_jetbrains_annotations_13_0.xml | 11 + ...g_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml | 11 + ...org_jetbrains_kotlin_kotlin_test_1_1_1.xml | 11 + ...tbrains_kotlin_kotlin_test_junit_1_1_1.xml | 11 + kotlin/nucleotide-count/.idea/misc.xml | 22 + kotlin/nucleotide-count/.idea/modules.xml | 10 + .../.idea/modules/nucleotide-count.iml | 12 + .../.idea/modules/nucleotide-count_main.iml | 40 + .../.idea/modules/nucleotide-count_test.iml | 46 + kotlin/nucleotide-count/.idea/workspace.xml | 1076 +++++++++++++++++ kotlin/nucleotide-count/README.md | 35 + kotlin/nucleotide-count/build.gradle | 28 + .../classes/main/DNA$nucleotideCounts$2.class | Bin 0 -> 3301 bytes .../build/classes/main/DNA.class | Bin 0 -> 2717 bytes .../build/classes/test/NucleotideTest.class | Bin 0 -> 3219 bytes .../build/kotlin-build/caches/version.txt | 1 + kotlin/nucleotide-count/src/main/kotlin/.keep | 0 .../nucleotide-count/src/main/kotlin/DNA.kt | 23 + .../src/test/kotlin/NucleotideTest.kt | 87 ++ kotlin/space-age/.idea/workspace.xml | 8 +- 62 files changed, 3548 insertions(+), 12 deletions(-) create mode 100644 kotlin/beer-song/.gradle/3.5/file-changes/last-build.bin create mode 100644 kotlin/beer-song/.gradle/3.5/taskHistory/taskHistory.lock create mode 100644 kotlin/beer-song/.gradle/buildOutputCleanup/built.bin create mode 100644 kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties create mode 100644 kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties.lock create mode 100644 kotlin/beer-song/.idea/compiler.xml create mode 100644 kotlin/beer-song/.idea/gradle.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml create mode 100644 kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml create mode 100644 kotlin/beer-song/.idea/misc.xml create mode 100644 kotlin/beer-song/.idea/modules.xml create mode 100644 kotlin/beer-song/.idea/modules/beer-song_main.iml create mode 100644 kotlin/beer-song/.idea/modules/beer-song_test.iml create mode 100644 kotlin/beer-song/.idea/workspace.xml create mode 100644 kotlin/beer-song/README.md create mode 100644 kotlin/beer-song/beer-song.iml create mode 100644 kotlin/beer-song/build.gradle create mode 100644 kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class create mode 100644 kotlin/beer-song/build/classes/main/BeerSong.class create mode 100644 kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class create mode 100644 kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class create mode 100644 kotlin/beer-song/build/classes/test/BeerSongTest$verse100$1.class create mode 100644 kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class create mode 100644 kotlin/beer-song/build/classes/test/BeerSongTest.class create mode 100644 kotlin/beer-song/build/kotlin-build/caches/version.txt create mode 100644 kotlin/beer-song/src/main/kotlin/.keep create mode 100644 kotlin/beer-song/src/main/kotlin/BeerSong.kt create mode 100644 kotlin/beer-song/src/test/kotlin/BeerSongTest.kt create mode 100644 kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin create mode 100644 kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock create mode 100644 kotlin/nucleotide-count/.gradle/buildOutputCleanup/built.bin create mode 100644 kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties create mode 100644 kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock create mode 100644 kotlin/nucleotide-count/.idea/compiler.xml create mode 100644 kotlin/nucleotide-count/.idea/gradle.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml create mode 100644 kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml create mode 100644 kotlin/nucleotide-count/.idea/misc.xml create mode 100644 kotlin/nucleotide-count/.idea/modules.xml create mode 100644 kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml create mode 100644 kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml create mode 100644 kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml create mode 100644 kotlin/nucleotide-count/.idea/workspace.xml create mode 100644 kotlin/nucleotide-count/README.md create mode 100644 kotlin/nucleotide-count/build.gradle create mode 100644 kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class create mode 100644 kotlin/nucleotide-count/build/classes/main/DNA.class create mode 100644 kotlin/nucleotide-count/build/classes/test/NucleotideTest.class create mode 100644 kotlin/nucleotide-count/build/kotlin-build/caches/version.txt create mode 100644 kotlin/nucleotide-count/src/main/kotlin/.keep create mode 100644 kotlin/nucleotide-count/src/main/kotlin/DNA.kt create mode 100644 kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt diff --git a/kotlin/beer-song/.gradle/3.5/file-changes/last-build.bin b/kotlin/beer-song/.gradle/3.5/file-changes/last-build.bin new file mode 100644 index 0000000000000000000000000000000000000000..f76dd238ade08917e6712764a16a22005a50573d GIT binary patch literal 1 IcmZPo000310RR91 literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/.gradle/3.5/taskHistory/taskHistory.lock b/kotlin/beer-song/.gradle/3.5/taskHistory/taskHistory.lock new file mode 100644 index 0000000000000000000000000000000000000000..85f45da2b278f39a1e9ac01e6fe8136444f513e8 GIT binary patch literal 17 TcmZR+d0f0_uaChp1}FdkHL(OH literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/.gradle/buildOutputCleanup/built.bin b/kotlin/beer-song/.gradle/buildOutputCleanup/built.bin new file mode 100644 index 0000000..e69de29 diff --git a/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties b/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties new file mode 100644 index 0000000..3bf8c05 --- /dev/null +++ b/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties @@ -0,0 +1,2 @@ +#Mon Jun 05 12:43:15 EDT 2017 +gradle.version=3.5 diff --git a/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties.lock b/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties.lock new file mode 100644 index 0000000..40fdece --- /dev/null +++ b/kotlin/beer-song/.gradle/buildOutputCleanup/cache.properties.lock @@ -0,0 +1 @@ + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/compiler.xml b/kotlin/beer-song/.idea/compiler.xml new file mode 100644 index 0000000..c767f78 --- /dev/null +++ b/kotlin/beer-song/.idea/compiler.xml @@ -0,0 +1,9 @@ + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/gradle.xml b/kotlin/beer-song/.idea/gradle.xml new file mode 100644 index 0000000..346dc7e --- /dev/null +++ b/kotlin/beer-song/.idea/gradle.xml @@ -0,0 +1,19 @@ + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml b/kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml new file mode 100644 index 0000000..04c10dd --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__junit_junit_4_12.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml b/kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml new file mode 100644 index 0000000..8262f72 --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml new file mode 100644 index 0000000..4f32fde --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml new file mode 100644 index 0000000..7b6f562 --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml new file mode 100644 index 0000000..1720158 --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml new file mode 100644 index 0000000..21c5d19 --- /dev/null +++ b/kotlin/beer-song/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/misc.xml b/kotlin/beer-song/.idea/misc.xml new file mode 100644 index 0000000..3e1805e --- /dev/null +++ b/kotlin/beer-song/.idea/misc.xml @@ -0,0 +1,22 @@ + + + + + + + + + + 1.8 + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/modules.xml b/kotlin/beer-song/.idea/modules.xml new file mode 100644 index 0000000..eed3ebb --- /dev/null +++ b/kotlin/beer-song/.idea/modules.xml @@ -0,0 +1,10 @@ + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/modules/beer-song_main.iml b/kotlin/beer-song/.idea/modules/beer-song_main.iml new file mode 100644 index 0000000..1a317fb --- /dev/null +++ b/kotlin/beer-song/.idea/modules/beer-song_main.iml @@ -0,0 +1,40 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/modules/beer-song_test.iml b/kotlin/beer-song/.idea/modules/beer-song_test.iml new file mode 100644 index 0000000..8764364 --- /dev/null +++ b/kotlin/beer-song/.idea/modules/beer-song_test.iml @@ -0,0 +1,46 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/.idea/workspace.xml b/kotlin/beer-song/.idea/workspace.xml new file mode 100644 index 0000000..4cb1fe2 --- /dev/null +++ b/kotlin/beer-song/.idea/workspace.xml @@ -0,0 +1,1030 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @ignore + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + 1496680992081 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/README.md b/kotlin/beer-song/README.md new file mode 100644 index 0000000..2bf06c3 --- /dev/null +++ b/kotlin/beer-song/README.md @@ -0,0 +1,329 @@ +# Beer Song + +Produce the lyrics to that beloved classic, that field-trip favorite: 99 Bottles of Beer on the Wall. + +Note that not all verses are identical. + +```plain +99 bottles of beer on the wall, 99 bottles of beer. +Take one down and pass it around, 98 bottles of beer on the wall. + +98 bottles of beer on the wall, 98 bottles of beer. +Take one down and pass it around, 97 bottles of beer on the wall. + +97 bottles of beer on the wall, 97 bottles of beer. +Take one down and pass it around, 96 bottles of beer on the wall. + +96 bottles of beer on the wall, 96 bottles of beer. +Take one down and pass it around, 95 bottles of beer on the wall. + +95 bottles of beer on the wall, 95 bottles of beer. +Take one down and pass it around, 94 bottles of beer on the wall. + +94 bottles of beer on the wall, 94 bottles of beer. +Take one down and pass it around, 93 bottles of beer on the wall. + +93 bottles of beer on the wall, 93 bottles of beer. +Take one down and pass it around, 92 bottles of beer on the wall. + +92 bottles of beer on the wall, 92 bottles of beer. +Take one down and pass it around, 91 bottles of beer on the wall. + +91 bottles of beer on the wall, 91 bottles of beer. +Take one down and pass it around, 90 bottles of beer on the wall. + +90 bottles of beer on the wall, 90 bottles of beer. +Take one down and pass it around, 89 bottles of beer on the wall. + +89 bottles of beer on the wall, 89 bottles of beer. +Take one down and pass it around, 88 bottles of beer on the wall. + +88 bottles of beer on the wall, 88 bottles of beer. +Take one down and pass it around, 87 bottles of beer on the wall. + +87 bottles of beer on the wall, 87 bottles of beer. +Take one down and pass it around, 86 bottles of beer on the wall. + +86 bottles of beer on the wall, 86 bottles of beer. +Take one down and pass it around, 85 bottles of beer on the wall. + +85 bottles of beer on the wall, 85 bottles of beer. +Take one down and pass it around, 84 bottles of beer on the wall. + +84 bottles of beer on the wall, 84 bottles of beer. +Take one down and pass it around, 83 bottles of beer on the wall. + +83 bottles of beer on the wall, 83 bottles of beer. +Take one down and pass it around, 82 bottles of beer on the wall. + +82 bottles of beer on the wall, 82 bottles of beer. +Take one down and pass it around, 81 bottles of beer on the wall. + +81 bottles of beer on the wall, 81 bottles of beer. +Take one down and pass it around, 80 bottles of beer on the wall. + +80 bottles of beer on the wall, 80 bottles of beer. +Take one down and pass it around, 79 bottles of beer on the wall. + +79 bottles of beer on the wall, 79 bottles of beer. +Take one down and pass it around, 78 bottles of beer on the wall. + +78 bottles of beer on the wall, 78 bottles of beer. +Take one down and pass it around, 77 bottles of beer on the wall. + +77 bottles of beer on the wall, 77 bottles of beer. +Take one down and pass it around, 76 bottles of beer on the wall. + +76 bottles of beer on the wall, 76 bottles of beer. +Take one down and pass it around, 75 bottles of beer on the wall. + +75 bottles of beer on the wall, 75 bottles of beer. +Take one down and pass it around, 74 bottles of beer on the wall. + +74 bottles of beer on the wall, 74 bottles of beer. +Take one down and pass it around, 73 bottles of beer on the wall. + +73 bottles of beer on the wall, 73 bottles of beer. +Take one down and pass it around, 72 bottles of beer on the wall. + +72 bottles of beer on the wall, 72 bottles of beer. +Take one down and pass it around, 71 bottles of beer on the wall. + +71 bottles of beer on the wall, 71 bottles of beer. +Take one down and pass it around, 70 bottles of beer on the wall. + +70 bottles of beer on the wall, 70 bottles of beer. +Take one down and pass it around, 69 bottles of beer on the wall. + +69 bottles of beer on the wall, 69 bottles of beer. +Take one down and pass it around, 68 bottles of beer on the wall. + +68 bottles of beer on the wall, 68 bottles of beer. +Take one down and pass it around, 67 bottles of beer on the wall. + +67 bottles of beer on the wall, 67 bottles of beer. +Take one down and pass it around, 66 bottles of beer on the wall. + +66 bottles of beer on the wall, 66 bottles of beer. +Take one down and pass it around, 65 bottles of beer on the wall. + +65 bottles of beer on the wall, 65 bottles of beer. +Take one down and pass it around, 64 bottles of beer on the wall. + +64 bottles of beer on the wall, 64 bottles of beer. +Take one down and pass it around, 63 bottles of beer on the wall. + +63 bottles of beer on the wall, 63 bottles of beer. +Take one down and pass it around, 62 bottles of beer on the wall. + +62 bottles of beer on the wall, 62 bottles of beer. +Take one down and pass it around, 61 bottles of beer on the wall. + +61 bottles of beer on the wall, 61 bottles of beer. +Take one down and pass it around, 60 bottles of beer on the wall. + +60 bottles of beer on the wall, 60 bottles of beer. +Take one down and pass it around, 59 bottles of beer on the wall. + +59 bottles of beer on the wall, 59 bottles of beer. +Take one down and pass it around, 58 bottles of beer on the wall. + +58 bottles of beer on the wall, 58 bottles of beer. +Take one down and pass it around, 57 bottles of beer on the wall. + +57 bottles of beer on the wall, 57 bottles of beer. +Take one down and pass it around, 56 bottles of beer on the wall. + +56 bottles of beer on the wall, 56 bottles of beer. +Take one down and pass it around, 55 bottles of beer on the wall. + +55 bottles of beer on the wall, 55 bottles of beer. +Take one down and pass it around, 54 bottles of beer on the wall. + +54 bottles of beer on the wall, 54 bottles of beer. +Take one down and pass it around, 53 bottles of beer on the wall. + +53 bottles of beer on the wall, 53 bottles of beer. +Take one down and pass it around, 52 bottles of beer on the wall. + +52 bottles of beer on the wall, 52 bottles of beer. +Take one down and pass it around, 51 bottles of beer on the wall. + +51 bottles of beer on the wall, 51 bottles of beer. +Take one down and pass it around, 50 bottles of beer on the wall. + +50 bottles of beer on the wall, 50 bottles of beer. +Take one down and pass it around, 49 bottles of beer on the wall. + +49 bottles of beer on the wall, 49 bottles of beer. +Take one down and pass it around, 48 bottles of beer on the wall. + +48 bottles of beer on the wall, 48 bottles of beer. +Take one down and pass it around, 47 bottles of beer on the wall. + +47 bottles of beer on the wall, 47 bottles of beer. +Take one down and pass it around, 46 bottles of beer on the wall. + +46 bottles of beer on the wall, 46 bottles of beer. +Take one down and pass it around, 45 bottles of beer on the wall. + +45 bottles of beer on the wall, 45 bottles of beer. +Take one down and pass it around, 44 bottles of beer on the wall. + +44 bottles of beer on the wall, 44 bottles of beer. +Take one down and pass it around, 43 bottles of beer on the wall. + +43 bottles of beer on the wall, 43 bottles of beer. +Take one down and pass it around, 42 bottles of beer on the wall. + +42 bottles of beer on the wall, 42 bottles of beer. +Take one down and pass it around, 41 bottles of beer on the wall. + +41 bottles of beer on the wall, 41 bottles of beer. +Take one down and pass it around, 40 bottles of beer on the wall. + +40 bottles of beer on the wall, 40 bottles of beer. +Take one down and pass it around, 39 bottles of beer on the wall. + +39 bottles of beer on the wall, 39 bottles of beer. +Take one down and pass it around, 38 bottles of beer on the wall. + +38 bottles of beer on the wall, 38 bottles of beer. +Take one down and pass it around, 37 bottles of beer on the wall. + +37 bottles of beer on the wall, 37 bottles of beer. +Take one down and pass it around, 36 bottles of beer on the wall. + +36 bottles of beer on the wall, 36 bottles of beer. +Take one down and pass it around, 35 bottles of beer on the wall. + +35 bottles of beer on the wall, 35 bottles of beer. +Take one down and pass it around, 34 bottles of beer on the wall. + +34 bottles of beer on the wall, 34 bottles of beer. +Take one down and pass it around, 33 bottles of beer on the wall. + +33 bottles of beer on the wall, 33 bottles of beer. +Take one down and pass it around, 32 bottles of beer on the wall. + +32 bottles of beer on the wall, 32 bottles of beer. +Take one down and pass it around, 31 bottles of beer on the wall. + +31 bottles of beer on the wall, 31 bottles of beer. +Take one down and pass it around, 30 bottles of beer on the wall. + +30 bottles of beer on the wall, 30 bottles of beer. +Take one down and pass it around, 29 bottles of beer on the wall. + +29 bottles of beer on the wall, 29 bottles of beer. +Take one down and pass it around, 28 bottles of beer on the wall. + +28 bottles of beer on the wall, 28 bottles of beer. +Take one down and pass it around, 27 bottles of beer on the wall. + +27 bottles of beer on the wall, 27 bottles of beer. +Take one down and pass it around, 26 bottles of beer on the wall. + +26 bottles of beer on the wall, 26 bottles of beer. +Take one down and pass it around, 25 bottles of beer on the wall. + +25 bottles of beer on the wall, 25 bottles of beer. +Take one down and pass it around, 24 bottles of beer on the wall. + +24 bottles of beer on the wall, 24 bottles of beer. +Take one down and pass it around, 23 bottles of beer on the wall. + +23 bottles of beer on the wall, 23 bottles of beer. +Take one down and pass it around, 22 bottles of beer on the wall. + +22 bottles of beer on the wall, 22 bottles of beer. +Take one down and pass it around, 21 bottles of beer on the wall. + +21 bottles of beer on the wall, 21 bottles of beer. +Take one down and pass it around, 20 bottles of beer on the wall. + +20 bottles of beer on the wall, 20 bottles of beer. +Take one down and pass it around, 19 bottles of beer on the wall. + +19 bottles of beer on the wall, 19 bottles of beer. +Take one down and pass it around, 18 bottles of beer on the wall. + +18 bottles of beer on the wall, 18 bottles of beer. +Take one down and pass it around, 17 bottles of beer on the wall. + +17 bottles of beer on the wall, 17 bottles of beer. +Take one down and pass it around, 16 bottles of beer on the wall. + +16 bottles of beer on the wall, 16 bottles of beer. +Take one down and pass it around, 15 bottles of beer on the wall. + +15 bottles of beer on the wall, 15 bottles of beer. +Take one down and pass it around, 14 bottles of beer on the wall. + +14 bottles of beer on the wall, 14 bottles of beer. +Take one down and pass it around, 13 bottles of beer on the wall. + +13 bottles of beer on the wall, 13 bottles of beer. +Take one down and pass it around, 12 bottles of beer on the wall. + +12 bottles of beer on the wall, 12 bottles of beer. +Take one down and pass it around, 11 bottles of beer on the wall. + +11 bottles of beer on the wall, 11 bottles of beer. +Take one down and pass it around, 10 bottles of beer on the wall. + +10 bottles of beer on the wall, 10 bottles of beer. +Take one down and pass it around, 9 bottles of beer on the wall. + +9 bottles of beer on the wall, 9 bottles of beer. +Take one down and pass it around, 8 bottles of beer on the wall. + +8 bottles of beer on the wall, 8 bottles of beer. +Take one down and pass it around, 7 bottles of beer on the wall. + +7 bottles of beer on the wall, 7 bottles of beer. +Take one down and pass it around, 6 bottles of beer on the wall. + +6 bottles of beer on the wall, 6 bottles of beer. +Take one down and pass it around, 5 bottles of beer on the wall. + +5 bottles of beer on the wall, 5 bottles of beer. +Take one down and pass it around, 4 bottles of beer on the wall. + +4 bottles of beer on the wall, 4 bottles of beer. +Take one down and pass it around, 3 bottles of beer on the wall. + +3 bottles of beer on the wall, 3 bottles of beer. +Take one down and pass it around, 2 bottles of beer on the wall. + +2 bottles of beer on the wall, 2 bottles of beer. +Take one down and pass it around, 1 bottle of beer on the wall. + +1 bottle of beer on the wall, 1 bottle of beer. +Take it down and pass it around, no more bottles of beer on the wall. + +No more bottles of beer on the wall, no more bottles of beer. +Go to the store and buy some more, 99 bottles of beer on the wall. +``` + +## For bonus points + +Did you get the tests passing and the code clean? If you want to, these +are some additional things you could try: + +* Remove as much duplication as you possibly can. +* Optimize for readability, even if it means introducing duplication. +* If you've removed all the duplication, do you have a lot of + conditionals? Try replacing the conditionals with polymorphism, if it + applies in this language. How readable is it? + +Then please share your thoughts in a comment on the submission. Did this +experiment make the code better? Worse? Did you learn anything from it? + +## Source + +Learn to Program by Chris Pine [http://pine.fm/LearnToProgram/?Chapter=06](http://pine.fm/LearnToProgram/?Chapter=06) + +## Submitting Incomplete Solutions +It's possible to submit an incomplete solution so you can see how others have completed the exercise. + diff --git a/kotlin/beer-song/beer-song.iml b/kotlin/beer-song/beer-song.iml new file mode 100644 index 0000000..9291a89 --- /dev/null +++ b/kotlin/beer-song/beer-song.iml @@ -0,0 +1,12 @@ + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/beer-song/build.gradle b/kotlin/beer-song/build.gradle new file mode 100644 index 0000000..16c36c0 --- /dev/null +++ b/kotlin/beer-song/build.gradle @@ -0,0 +1,28 @@ +buildscript { + ext.kotlin_version = '1.1.1' + repositories { + mavenCentral() + } + dependencies { + classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version" + } +} + +apply plugin: 'kotlin' + +repositories { + mavenCentral() +} + +dependencies { + compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version" + + testCompile 'junit:junit:4.12' + testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version" +} +test { + testLogging { + exceptionFormat = 'full' + events = ["passed", "failed", "skipped"] + } +} diff --git a/kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class b/kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class new file mode 100644 index 0000000000000000000000000000000000000000..6a380013a9fa10703ce4d42d889e754e234ec04b GIT binary patch literal 1082 zcmZ`&+iuf95It+>>V`JG(0j|J1(HJRG~7w3RH{~33IUNS66({&G3h4GTC$x;ee1XI z1ze<70tr<-@==J{G--nX%ku7=nLRUmX8iNl*Y5!GC@_q_a2&tl$;PUCbx-Qd*6|EC_EXMd;MLmSZeYvH(f3pW+n86Y!tRA z)BOJ#`<21wWec-l;cmhpFD*G3iO_QG<xUh=~rf}7u*lC7Hcqk}x@`C9?cuE{A3Ms-Z20fFlQf$V`R#TYAqJb!usFb2j zP3c9954!Nm33;7|oQ`Ylu1<|*>O*R2wVnwE)>4p8P<@kO@$5KZoE;lldX$#*+3~!V zV=s*#A7WZUQ!#mlks_C#JZgKLfXaa?VnJ!RuI@dTq@77Y12r~UAyvEM)u}aOB_W-1 zr(JXWeO_}3nJ9TScdOhN%I<>;Z#yy+ZO4*b5eUM!FI&NotcZr>VaKQAM#by+wzDS` z*VwMKT`!=aqI(~Db%vBBrQ`3oJm|GxuFqTjixoMlI!bELgkw%!gEWbxw`n|*gyhLu zQd-d(T{}VQBW)P&(>K-w>1R=sL?kNo0rVbfe8yzj)=w~_;x)pRT8hNLY%j$ngN}!U zE4C}NLTO5S#Wq1F)tT6uev0K!%1ODdUHE6nubz=_(B7S5;|p@aKFccFfgtlZYt&oug@!rcIh&1R8AOCK04f+Vo1#Kd1DY)#~sO>Yt=}GxO%XH{Uzv`JMm1 z`Z|C#{v#o@PuK0Sk~O73k`Ozs&1gwev!;@VCr;~mS3!$})#j{i^Zt7E-t4mmw zJ5zE^!%F6~hh_&PY|54FspM(hov<~-a*~>5m0Zm=N~A|i?r7OG$rYZ`-JB;%!n)oq zxrVYa*EX!FfhbxL3`2%0p`)j+uW-aJP3yL6=#GT$6E)qoK55d#>h7gj*Yz%$fo|bI_hD7j?@WK9|?01w;xqN(kOzScZG2gqGed<5Ap#E|smqdz##QFQNN333mEM2KFbGZTs3wmj2%Ams-43Z?A;)4WCrQV_(@Y z3%aeKPsLW@wV*aVty={N8&`@8pPeDM4co>*DQUfkiJX8 znx)dWhp=0ML>%`pNIjq25S0)z5^h>5Wf3+Z+`%k!OI1jsxD#Qa{VwLBmn5U*;)HHf zX_okSD@>-&-t5YW)9L50&0?fG$*kob6_kQuCY?CsWy#$tM(|<6yo{SgVanDW$4jsS zRJ54G6XqObfy>coTlegtzwYd&1Y>yca>4)w8`lMDiT?t*y;ZajL zklm7v;yxT#aWC#?5o17l(0x?JJ@^=lp=YLNPD7c3lZ3?(X0tj7H~Deq@p-bj&H&ah z5y2Spwd*e0SHQ}soYI_8{T%IMX}dp)DV&O65(Yzlh5ORaHR%e@@U+FFT=Y)!B1Kp# zOq6I{c6996;ONkB6b~XUs=gh?26U^W1iMzCJ3E>o@e92$Vg_d;cmU@lv^B0@b;Lsw z5W>SmN~n(FQ{q*a#HT6Dx7X!*vKr-H1U*7y3Vfn+nnT5#n^ji1=!4~n8^vewsEW_v za}s2O2h|>JEC%X@ii ztesWXB@QOD&^IZx9V432W)-|oZBGE17v61B=wFJN%mj{jR;PO=OD6GF*&>L?%`?0C zjE_C>rnqvkY>K$@xK#1*8Jg)$!k%7V)}&!O?s)Zm4Vwhlqg4b%g{h`G}<#pGn!^0REjr*!kwV&M() zjzBsXQ#nQsbjG6oe3h7Uy-kcqyJIb4eb2~!*B-m}s5l)}10f|A+7Jk}#)8*g46YW2 zq*=VHh|`y%-`M7`dpucW-^U8%Be$$IQ!po?&)*f;85V1crJ2cE^LA99)NS3$>#1yU z+Ej35v9Id<hY#1a{2#6r=xb{6XCAkD@X%b0W3O*?xvqr~7Exa*d*%wPp;* zU>O-~^zMxNp;Cc0yggUSYv#CS8{!o^CVp6za=c^pQTJC?jk#L>%pq2kDu+5&D%*K| z#1QQ3s+0ZtM0slXoU2>nX=dTcT13ioglO;MzB%K|j6sU#2bdi#tn&OnfvNEqkt-Y( zAl4;%f6n9LHQ?CFPCf+jEc}(TUH;k5i-_d<4qe3Rmh|Y>E9j6=!TJm2knlJDMmYkV z=<;MV$)_~FExxq3XoF0?>F$?%lMG6v&FNsv#Q^> zla^o*`)K>S31z}Qgz+!|ic@YCI--FQJUx!DbGOB#zQMH!o~C0T$2TcOP~RdI z@~CfnCmzRb_zu2H$usOxzelPSHV*hw1oeHc1-!KrkM>A0%yKJvDaGk{C-$oV6|HxqTM`*O^0#0$Gw2jCr32 z6t*@x|7IdUMI90e7vUJfOLdudaVGvY2VTSc@s|q_IPTN7SZbr&b>bwQnp@qej%NiBzJQr$%!l zojBR(h#gi-)qlVm9k`Qh;yCD@JlTBWpsV)f)YPU_e`-%ArKZxUotx5`)Lv41NcHc` zq<5&PUFmd{-l_HtH*E9jq}q1_1BL9}n^K-Yj=ngb@`T}EghM4T&v2x#@NfPWIR80g z@fRo1lEp8*&#&<7+Ux=s@Ur;1c!CWcF5x#P5OWZB@UVkh9K7NYAqQaxtqy_?HaHmc O7Ka=>>EI~`m;VPkBhxYf literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class new file mode 100644 index 0000000000000000000000000000000000000000..bc9813501afc38e765ddad1d803df47ca2e48d6a GIT binary patch literal 1096 zcmZ`%YflqF6g{&oeJsT;h`dA|ids;h&a?focWqhog(E$4r+Z50dhyp% z_}R@Y!_@i7q6jn0^u_;^Fp3C6M97ZQv=~NHi^T)p;ik=H!+cpiuxdWN5lSsq5{N<9 zp<$3=u$xnnh+>E#R@g0-^SfKy3`2i0Odts(jtdwjP*0pFE;8uFo|#pkOL2^1jHq;! zU>?I*s!-@BQ}SIQ8-$&}q)yl=hOoac2swY2=^WLmf=Esf*G;;UDyUj!Fsow#bHplF zqh18D;U4uDme1?l=X6nPbwbo#rWR64s|F?*SW~$|;FrcVxI`pKcL85(WI$>Efi zX3z8=A0k>zQP{-i$Yqv?N-%t%e-onXQb%VxLx6{Pu*@=^9ovb<9sd~hgj*$3_k&kp{ct~p`@JBGLCXLPty^2uaCFHnKH>yXt{N@w+ zHDqZ`oW?L6yz?i=Q;Lyf-5eu?Rxd`DLdTd_x9N3UJ&TW1Tz!MzpuIiD{V#ZM3K~F; z+!|5X2=+B>(jGVea%6L?Ja2HDrB{DnP)3b-EpH*m9OrO1KB0+w)V56r`D N+@X+%We=u@*l!ZR>DmAQ literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class new file mode 100644 index 0000000000000000000000000000000000000000..fa3a3a5f2e4854c5b3da95abfd0225bb1d18e5bd GIT binary patch literal 1100 zcmZ`%ZBG+H5PtSruI*85smPm%AgBeEYXM(d(Aq$3EST6@WB9af&$6`LOYW{s{Kjwb z7bqr>Xkv&T{ZYo*qs1EKa@pOPd3N@hXXfXxuipWzBF8ZQ+_IdKEgNOa^%h+^R4m7} z*2?ydkR3O@m=1w4yeu|tuO*~;&~2MSdX^)3%PjJCwaznxvG*NW^Moy3bGvs+W&80r zQh1ro48!!r$wCM+%nro=lQ0CGK^L-XH!X&-FDy5~wdv2$va*V&BXt(3J?rFiupu zN-~#WJXt6Vk|}wPkPX64V#*-wG(*ta7ld3m&vc>gRD+%s#CDTzB@3#WSzI?TggN4s ztx-4p*l3^pj^*(>_c&eD+T8$kn5l)d(yG1*2G&%r0J-XEhMCjDuyJ~5XmO3U`03%a zmSQiAA0KrstSQVY>6YcvmLJ-7$0Z_^BHGtLF%Kcdkob3OqBLEGBJ9h*uGG2~p+-Dl zhz;IfX?j#$-mX(4V?`mY-A=n|Ib~jLktb2KYrIwAj!<^b87YZ|$wU+IY;-tjBT_>sqDJ>`8;;!GGsn;FpiMCY{uAqE5DQ%DY!-^Df8=~T9*fFKZ zl1jmNj^-yqp2uX((N6UvynKx45fY#1%OFlqaDsVto8HEa^Y{eC)i?YN+Pf3n|AL2Spdn<* ztr39@e}9Bc+Ji`A4NvK$9yq%?iDzVQki9^~FYX~wz)kScYzAlih6--}o*5 z0>uOpO$_nTA7#9=v{;Qc&Cc9=&zw2;%>D86%QpZ^C^1Yt6~e2!s<|cnV6H1XU*vPS zxqKXq;d!Oy298wrUbk&a6$npp$FA^pt-%X}wRas=52UMnd!x6@75nwqN(P110>kwG z$>NAITpXzXgD?)0!IY}&wgkgicD}O5yWDoTYT7Srd!ioD9g*z(b_xkt77PqA4D~p* zh&YBB66MY6R%vr>oniP7g(;+wN#YDf2-G(vj-`NRs9E7}A5M7Fz-JwB|PG z$fK zmR9N-iG@R?4lw$W_6(2cYle9fBYLiAuhGlIr_t5{CNhmfoPYC)A_E2brcNrD32*t$ zuuL^Ftj93gV=xyYN4Ts{)7`joTA!f0{tbPF@%9LJKjZ!hD25`X4MeaKt`D$EYZQ6h z!DHI#3r>zs;t9no6knz0=XMY&<68K?jvM_bO9{-Ev4ER9U_Nf)HkEuV`mlW@egWGJ B;1>V@ literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class new file mode 100644 index 0000000000000000000000000000000000000000..c6cd93ec094eddc0e2988039582b1b742519fab5 GIT binary patch literal 1076 zcmZ`%YflqF6g{)0ucg?6AP-SdQ41<<@ofuQ3B<;NiA9Xz)3jY-X*-+jZkzax-{LP& zOd!$35I_2(jAxb>Yt+qVX70Ub?mhR+{qgh5Hvo$$3QRq-EVtsQolVR0XFHbbS?jiH zd%4+M6hh!dx#9RtTV?h-t&FXF%T=TweBff=*3?v+s`lO zS?&MHq8Jdk*cbmt!YCpF5nFYfh9xkXo-6Okj?6Tr+R41E?pZaTHA3mRtps8)O&Ayy z80_ZMB%&A+h?O=fo5hWlRe_;D7$%TJDvmQ4Ca9-N6lVp@a?i|b&{!O!I42Me^b#0L zm-?wxeAiYxL{4DRByvh%z~8k!f$7scf6Gnkk%CQ<%Y-u_o4ANeCc>B@okER|5X6Ri zoYyU1)}=3b(P(u-d{LnnN@P?669S^4T_L*aIhH@(kD15&rjatZrH=QfjI4NWe*X|L zVur>nQm%qjj(Xp6+8&88MWWZbrW{3x@HZEbg*@ru2pq~CT4Fe^^mtyycfMkiNQt?78w zm=f$db#g2zWw|R&>3J4qo_y6-zTL96Y|m!CqEe18gW*J$+`{aN!;MKzmhudwikz1? zJ&$P3aA)I)%^xChfRT?p3q0l;3H%WZ>*?ZIqwg@EM#m2@ZXDwLn@=I-9Tse)8Gp@hEuQ1*o;ofIFI01!GpxZzQOTqpS%iIT$ zBc~@k=>jKLC-9W^678$(eRdn660QaRb=>G#X*w`h!aQznLwLA_+YEVF@R0Ek`vqJ5 Br)iz6~<44z|bPXcv*FK-PR=$Tx0;Rvurk^@xqFj6;?NKleK|%938sd=^oTv zs@#7i`I4{kgR$}T&ol4uy*@oazkmPdU;jo# z)AW0X2Cf7_eK86vOF^9Uk>k+N6Mx+=)%>thy0iQwSi#k9hkDn8dK^qT)IB>!zH`Q*?-wF(Evg6Ja+D;sAoik1-ZBdJqR>ko2i|kPRvY)i&ZY_XM&u>< z4`ZC9rTF2hx7>K?#nD=jl{@a0%UanJZh;C871|BzBNwmc78aLg7p`7&$enL1GXpe0 z`}%1w4La15HO!$yqjO{P8%ea9U=MW9Ma26dp@-#|n)v%PHy`|YW4(drY3gcVo zpo0z_^s_71zH9ikcw{wr27tb&_ z!Ky>WP2Seq9omyTuEq`x=B;iGQ*$7v99o}h^=9XR;_8IEkS!Is zsFj&^!H*p3%jR9VjDgVSb*Fi6sYF>+o%h42LwmDY+^&X=7*pcp#{8eF)q;v&o2^$G zYeAS?d$AHcOQ(Aued5sZ)=GG?zE-M+Nl*{{TIp`^sD=rddCoX=xDq6H>R0Q5p9HtE zg>$ur`Qp&&%_}0iHZwNgDzM%xqjalzeSk_d>CyzDZYR>!i!=x;URGys#Sc#g5x|;=h?U?WXt5;VFkIWKJE$G!n~lbT36M_Jt13|=XGX*=Gs|> zm2-G>uJb+W7R{&ksN0(d=j>86={Wy5s{zJ6AzLafLV0VjxT^ji$#hqX{Be(~tw#Ra z_cHf?;3Ln^@nI}qkyx!uQ5os=(Ux`2^>n>2B2u@mcj?O3{a5|8MEJ;8%ymqy_8sHQ zM(#B8xDqw*%eXB>o}XuPGldHDi&l^?wmxx=$U@V~J#gsbZ7P?;N2aps{i>h7pnhGSI&utGOs zMaXchY5-Q~Caeez9IG0D6}ky4LWW~i1F%9jVMWMrtZD#O=q9WP8IDyAzzW@j z6(Pg1ssUJ`o3J8eI94?PD|8c9gbc^324ID5!itdLSk(Zm&`nqoG90TKfEBt0dtQVL z!|H}{PwFPD2pNu54ZsTBgcTvfv8n-Bp_{NGWH?qe04sD8R)h@4ss><%Zo-O?;aJrG ztk6wZ5i%UB8h{nL2`fT|V^ssNLN{SW$Z)J`09NQGtOyy7RSm!j-GV*0Q%dQEaZlJ%%kl|R>0IbkWSP?QDs~Uh6x(O>n zhGSI&utGOsMaXchY5-Q~CaeeJ%%kl|R>0IbkWSP?QDs~Uh6x(O>nhGSI&utGOsMaXchY5-Q~CaeeJ%%kl|R>0IbkWSP?QDs~Uh6x(O>nhGSI& zutGOsMaXchY5-Q~CaeeUDX##D9u z0d+S_5iN|V>iBcWZkQrh7*o~p%gx;|MW`^Qs^eD`yJ3n%VN6xW4<5T=ia23RRmaDO z-7wo((rLpOp54@BL_&+$esgPa{$D(U?>p3w?N0MA>(v$P(>OS~dGAiXlW>Jr(_Inojzy7cZBym*kN16t7mX zDe8~!ULAD1j&!+QL+@U>U4`@nUxk4q?_N!JO*&V4e)vN#E`3oL>OR&rx#wmd&U*5* z-u$dDKP%*C{rQ=jpY6@h2J*9g`PpE8w!eAy!=HMG(yC&oAF4gLj4fPe(kK4EUGu9U z_D^lzr7-an+a>p0jaJb?#rbH(uif+O)pXO-Qu+<<`Dz#}G}e}bdh5#3yA3?_zZTr9 z##LBm!!Sy)6%3m)u^(VDYSdSP>(%tF19M>*)U!=xK}=KBg-%cZ?W1Appj)mWAr{+1TTF+AL95DUxQExBixPc zrNb!uH+a#VLYw0OcNJoD&^5A7`ANU2%?ra}1pK8D}Kt+-ddO zf#Q!d&QM`n&`{oS2Smqt0G&XGo@Ag?9YAAE(8{hrrvMrSXpDhQ=b+1QWTRUge@oNF zbFZoVj%MD{Pw#KcgaI-BZZ>-+&{ri^^5yMHzVe!Gm`gr~lFze}Z{{U`*&2mI#V=Z; zFx2~o7CKMhVm=Os#5k1E_)jsdW*F*Dj@lUTFEdmxR?0RYZNSrBp2av^VW7J?h>Zh! z>%O_SZlJervXZ~vuH;|7rfV(Zae~*hTB~ zI~-3U2`}JCbOhTwo5!Wr@tf8$&9MsJ{RCBe`hdFUsFwX-qp`Q*TTUvy;0q-HGYzm~O_@6VvgSF2{5trjeLV#dJER#=ijWdC{Z* literal 0 HcmV?d00001 diff --git a/kotlin/beer-song/build/kotlin-build/caches/version.txt b/kotlin/beer-song/build/kotlin-build/caches/version.txt new file mode 100644 index 0000000..01aabac --- /dev/null +++ b/kotlin/beer-song/build/kotlin-build/caches/version.txt @@ -0,0 +1 @@ +11001 \ No newline at end of file diff --git a/kotlin/beer-song/src/main/kotlin/.keep b/kotlin/beer-song/src/main/kotlin/.keep new file mode 100644 index 0000000..e69de29 diff --git a/kotlin/beer-song/src/main/kotlin/BeerSong.kt b/kotlin/beer-song/src/main/kotlin/BeerSong.kt new file mode 100644 index 0000000..86e3a7e --- /dev/null +++ b/kotlin/beer-song/src/main/kotlin/BeerSong.kt @@ -0,0 +1,18 @@ +object BeerSong { + val lyrics: String by lazy { + verses(99, 0) + } + fun verse(verseNumber: Int): String{ + if (verseNumber < 0 || verseNumber > 99) throw IllegalArgumentException() + when (verseNumber){ + 0 -> return "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n" + 1 -> return "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n" + 2 -> return "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n" + else -> return "${verseNumber} bottles of beer on the wall, ${verseNumber} bottles of beer.\nTake one down and pass it around, ${verseNumber -1} bottles of beer on the wall.\n" + } + } + + fun verses(firstVerse: Int, lastVerse: Int): String{ + return (IntRange(lastVerse, firstVerse).reversed()).map { verse(it) }.fold("", {acc, s -> acc + s + "\n" }).dropLast(1) + } +} \ No newline at end of file diff --git a/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt b/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt new file mode 100644 index 0000000..9bdf971 --- /dev/null +++ b/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt @@ -0,0 +1,386 @@ +import org.junit.Test +import org.junit.Ignore +import kotlin.test.assertEquals +import kotlin.test.assertFailsWith + +class BeerSongTest { + + + @Test + fun verse0() { + val expected = "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verse(0)) + } + + + @Test + fun verse1() { + val expected = "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verse(1)) + } + + + @Test + fun verse2() { + val expected = "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n" + assertEquals(expected, BeerSong.verse(2)) + } + + + @Test + fun verse8() { + val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verse(8)) + } + + + @Test + fun verse99() { + val expected = "99 bottles of beer on the wall, 99 bottles of beer.\nTake one down and pass it around, 98 bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verse(99)) + } + + + @Test + fun verseMinus1() { + assertFailsWith(IllegalArgumentException::class, "Beer song verse can't be negative", { BeerSong.verse(-1) }) + } + + + @Test + fun verse100() { + assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verse(100) }) + } + + @Test + fun songVerse8To6() { + val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n\n7 bottles of beer on the wall, 7 bottles of beer.\nTake one down and pass it around, 6 bottles of beer on the wall.\n\n6 bottles of beer on the wall, 6 bottles of beer.\nTake one down and pass it around, 5 bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verses(8, 6)) + } + + + @Test + fun songVerse3To0() { + val expected = "3 bottles of beer on the wall, 3 bottles of beer.\nTake one down and pass it around, 2 bottles of beer on the wall.\n\n2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n\n1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n\nNo more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n" + assertEquals(expected, BeerSong.verses(3, 0)) + } + + + @Test + fun songVerse100To98() { + assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verses(100, 98) }) + } + + + @Test + fun songVerse3ToMinus1() { + assertFailsWith(IllegalArgumentException::class, "Beer song can't go down into a negative verse", { BeerSong.verses(3, -1) }) + } + + + @Test + fun entireSong() { + val expected = + """99 bottles of beer on the wall, 99 bottles of beer. +Take one down and pass it around, 98 bottles of beer on the wall. + +98 bottles of beer on the wall, 98 bottles of beer. +Take one down and pass it around, 97 bottles of beer on the wall. + +97 bottles of beer on the wall, 97 bottles of beer. +Take one down and pass it around, 96 bottles of beer on the wall. + +96 bottles of beer on the wall, 96 bottles of beer. +Take one down and pass it around, 95 bottles of beer on the wall. + +95 bottles of beer on the wall, 95 bottles of beer. +Take one down and pass it around, 94 bottles of beer on the wall. + +94 bottles of beer on the wall, 94 bottles of beer. +Take one down and pass it around, 93 bottles of beer on the wall. + +93 bottles of beer on the wall, 93 bottles of beer. +Take one down and pass it around, 92 bottles of beer on the wall. + +92 bottles of beer on the wall, 92 bottles of beer. +Take one down and pass it around, 91 bottles of beer on the wall. + +91 bottles of beer on the wall, 91 bottles of beer. +Take one down and pass it around, 90 bottles of beer on the wall. + +90 bottles of beer on the wall, 90 bottles of beer. +Take one down and pass it around, 89 bottles of beer on the wall. + +89 bottles of beer on the wall, 89 bottles of beer. +Take one down and pass it around, 88 bottles of beer on the wall. + +88 bottles of beer on the wall, 88 bottles of beer. +Take one down and pass it around, 87 bottles of beer on the wall. + +87 bottles of beer on the wall, 87 bottles of beer. +Take one down and pass it around, 86 bottles of beer on the wall. + +86 bottles of beer on the wall, 86 bottles of beer. +Take one down and pass it around, 85 bottles of beer on the wall. + +85 bottles of beer on the wall, 85 bottles of beer. +Take one down and pass it around, 84 bottles of beer on the wall. + +84 bottles of beer on the wall, 84 bottles of beer. +Take one down and pass it around, 83 bottles of beer on the wall. + +83 bottles of beer on the wall, 83 bottles of beer. +Take one down and pass it around, 82 bottles of beer on the wall. + +82 bottles of beer on the wall, 82 bottles of beer. +Take one down and pass it around, 81 bottles of beer on the wall. + +81 bottles of beer on the wall, 81 bottles of beer. +Take one down and pass it around, 80 bottles of beer on the wall. + +80 bottles of beer on the wall, 80 bottles of beer. +Take one down and pass it around, 79 bottles of beer on the wall. + +79 bottles of beer on the wall, 79 bottles of beer. +Take one down and pass it around, 78 bottles of beer on the wall. + +78 bottles of beer on the wall, 78 bottles of beer. +Take one down and pass it around, 77 bottles of beer on the wall. + +77 bottles of beer on the wall, 77 bottles of beer. +Take one down and pass it around, 76 bottles of beer on the wall. + +76 bottles of beer on the wall, 76 bottles of beer. +Take one down and pass it around, 75 bottles of beer on the wall. + +75 bottles of beer on the wall, 75 bottles of beer. +Take one down and pass it around, 74 bottles of beer on the wall. + +74 bottles of beer on the wall, 74 bottles of beer. +Take one down and pass it around, 73 bottles of beer on the wall. + +73 bottles of beer on the wall, 73 bottles of beer. +Take one down and pass it around, 72 bottles of beer on the wall. + +72 bottles of beer on the wall, 72 bottles of beer. +Take one down and pass it around, 71 bottles of beer on the wall. + +71 bottles of beer on the wall, 71 bottles of beer. +Take one down and pass it around, 70 bottles of beer on the wall. + +70 bottles of beer on the wall, 70 bottles of beer. +Take one down and pass it around, 69 bottles of beer on the wall. + +69 bottles of beer on the wall, 69 bottles of beer. +Take one down and pass it around, 68 bottles of beer on the wall. + +68 bottles of beer on the wall, 68 bottles of beer. +Take one down and pass it around, 67 bottles of beer on the wall. + +67 bottles of beer on the wall, 67 bottles of beer. +Take one down and pass it around, 66 bottles of beer on the wall. + +66 bottles of beer on the wall, 66 bottles of beer. +Take one down and pass it around, 65 bottles of beer on the wall. + +65 bottles of beer on the wall, 65 bottles of beer. +Take one down and pass it around, 64 bottles of beer on the wall. + +64 bottles of beer on the wall, 64 bottles of beer. +Take one down and pass it around, 63 bottles of beer on the wall. + +63 bottles of beer on the wall, 63 bottles of beer. +Take one down and pass it around, 62 bottles of beer on the wall. + +62 bottles of beer on the wall, 62 bottles of beer. +Take one down and pass it around, 61 bottles of beer on the wall. + +61 bottles of beer on the wall, 61 bottles of beer. +Take one down and pass it around, 60 bottles of beer on the wall. + +60 bottles of beer on the wall, 60 bottles of beer. +Take one down and pass it around, 59 bottles of beer on the wall. + +59 bottles of beer on the wall, 59 bottles of beer. +Take one down and pass it around, 58 bottles of beer on the wall. + +58 bottles of beer on the wall, 58 bottles of beer. +Take one down and pass it around, 57 bottles of beer on the wall. + +57 bottles of beer on the wall, 57 bottles of beer. +Take one down and pass it around, 56 bottles of beer on the wall. + +56 bottles of beer on the wall, 56 bottles of beer. +Take one down and pass it around, 55 bottles of beer on the wall. + +55 bottles of beer on the wall, 55 bottles of beer. +Take one down and pass it around, 54 bottles of beer on the wall. + +54 bottles of beer on the wall, 54 bottles of beer. +Take one down and pass it around, 53 bottles of beer on the wall. + +53 bottles of beer on the wall, 53 bottles of beer. +Take one down and pass it around, 52 bottles of beer on the wall. + +52 bottles of beer on the wall, 52 bottles of beer. +Take one down and pass it around, 51 bottles of beer on the wall. + +51 bottles of beer on the wall, 51 bottles of beer. +Take one down and pass it around, 50 bottles of beer on the wall. + +50 bottles of beer on the wall, 50 bottles of beer. +Take one down and pass it around, 49 bottles of beer on the wall. + +49 bottles of beer on the wall, 49 bottles of beer. +Take one down and pass it around, 48 bottles of beer on the wall. + +48 bottles of beer on the wall, 48 bottles of beer. +Take one down and pass it around, 47 bottles of beer on the wall. + +47 bottles of beer on the wall, 47 bottles of beer. +Take one down and pass it around, 46 bottles of beer on the wall. + +46 bottles of beer on the wall, 46 bottles of beer. +Take one down and pass it around, 45 bottles of beer on the wall. + +45 bottles of beer on the wall, 45 bottles of beer. +Take one down and pass it around, 44 bottles of beer on the wall. + +44 bottles of beer on the wall, 44 bottles of beer. +Take one down and pass it around, 43 bottles of beer on the wall. + +43 bottles of beer on the wall, 43 bottles of beer. +Take one down and pass it around, 42 bottles of beer on the wall. + +42 bottles of beer on the wall, 42 bottles of beer. +Take one down and pass it around, 41 bottles of beer on the wall. + +41 bottles of beer on the wall, 41 bottles of beer. +Take one down and pass it around, 40 bottles of beer on the wall. + +40 bottles of beer on the wall, 40 bottles of beer. +Take one down and pass it around, 39 bottles of beer on the wall. + +39 bottles of beer on the wall, 39 bottles of beer. +Take one down and pass it around, 38 bottles of beer on the wall. + +38 bottles of beer on the wall, 38 bottles of beer. +Take one down and pass it around, 37 bottles of beer on the wall. + +37 bottles of beer on the wall, 37 bottles of beer. +Take one down and pass it around, 36 bottles of beer on the wall. + +36 bottles of beer on the wall, 36 bottles of beer. +Take one down and pass it around, 35 bottles of beer on the wall. + +35 bottles of beer on the wall, 35 bottles of beer. +Take one down and pass it around, 34 bottles of beer on the wall. + +34 bottles of beer on the wall, 34 bottles of beer. +Take one down and pass it around, 33 bottles of beer on the wall. + +33 bottles of beer on the wall, 33 bottles of beer. +Take one down and pass it around, 32 bottles of beer on the wall. + +32 bottles of beer on the wall, 32 bottles of beer. +Take one down and pass it around, 31 bottles of beer on the wall. + +31 bottles of beer on the wall, 31 bottles of beer. +Take one down and pass it around, 30 bottles of beer on the wall. + +30 bottles of beer on the wall, 30 bottles of beer. +Take one down and pass it around, 29 bottles of beer on the wall. + +29 bottles of beer on the wall, 29 bottles of beer. +Take one down and pass it around, 28 bottles of beer on the wall. + +28 bottles of beer on the wall, 28 bottles of beer. +Take one down and pass it around, 27 bottles of beer on the wall. + +27 bottles of beer on the wall, 27 bottles of beer. +Take one down and pass it around, 26 bottles of beer on the wall. + +26 bottles of beer on the wall, 26 bottles of beer. +Take one down and pass it around, 25 bottles of beer on the wall. + +25 bottles of beer on the wall, 25 bottles of beer. +Take one down and pass it around, 24 bottles of beer on the wall. + +24 bottles of beer on the wall, 24 bottles of beer. +Take one down and pass it around, 23 bottles of beer on the wall. + +23 bottles of beer on the wall, 23 bottles of beer. +Take one down and pass it around, 22 bottles of beer on the wall. + +22 bottles of beer on the wall, 22 bottles of beer. +Take one down and pass it around, 21 bottles of beer on the wall. + +21 bottles of beer on the wall, 21 bottles of beer. +Take one down and pass it around, 20 bottles of beer on the wall. + +20 bottles of beer on the wall, 20 bottles of beer. +Take one down and pass it around, 19 bottles of beer on the wall. + +19 bottles of beer on the wall, 19 bottles of beer. +Take one down and pass it around, 18 bottles of beer on the wall. + +18 bottles of beer on the wall, 18 bottles of beer. +Take one down and pass it around, 17 bottles of beer on the wall. + +17 bottles of beer on the wall, 17 bottles of beer. +Take one down and pass it around, 16 bottles of beer on the wall. + +16 bottles of beer on the wall, 16 bottles of beer. +Take one down and pass it around, 15 bottles of beer on the wall. + +15 bottles of beer on the wall, 15 bottles of beer. +Take one down and pass it around, 14 bottles of beer on the wall. + +14 bottles of beer on the wall, 14 bottles of beer. +Take one down and pass it around, 13 bottles of beer on the wall. + +13 bottles of beer on the wall, 13 bottles of beer. +Take one down and pass it around, 12 bottles of beer on the wall. + +12 bottles of beer on the wall, 12 bottles of beer. +Take one down and pass it around, 11 bottles of beer on the wall. + +11 bottles of beer on the wall, 11 bottles of beer. +Take one down and pass it around, 10 bottles of beer on the wall. + +10 bottles of beer on the wall, 10 bottles of beer. +Take one down and pass it around, 9 bottles of beer on the wall. + +9 bottles of beer on the wall, 9 bottles of beer. +Take one down and pass it around, 8 bottles of beer on the wall. + +8 bottles of beer on the wall, 8 bottles of beer. +Take one down and pass it around, 7 bottles of beer on the wall. + +7 bottles of beer on the wall, 7 bottles of beer. +Take one down and pass it around, 6 bottles of beer on the wall. + +6 bottles of beer on the wall, 6 bottles of beer. +Take one down and pass it around, 5 bottles of beer on the wall. + +5 bottles of beer on the wall, 5 bottles of beer. +Take one down and pass it around, 4 bottles of beer on the wall. + +4 bottles of beer on the wall, 4 bottles of beer. +Take one down and pass it around, 3 bottles of beer on the wall. + +3 bottles of beer on the wall, 3 bottles of beer. +Take one down and pass it around, 2 bottles of beer on the wall. + +2 bottles of beer on the wall, 2 bottles of beer. +Take one down and pass it around, 1 bottle of beer on the wall. + +1 bottle of beer on the wall, 1 bottle of beer. +Take it down and pass it around, no more bottles of beer on the wall. + +No more bottles of beer on the wall, no more bottles of beer. +Go to the store and buy some more, 99 bottles of beer on the wall. +""" + assertEquals(expected, BeerSong.lyrics) + } +} diff --git a/kotlin/isogram/.idea/workspace.xml b/kotlin/isogram/.idea/workspace.xml index 28ef3dd..573ca2b 100644 --- a/kotlin/isogram/.idea/workspace.xml +++ b/kotlin/isogram/.idea/workspace.xml @@ -35,8 +35,8 @@ - - + + @@ -415,8 +415,6 @@ - - @@ -445,11 +443,13 @@ + + - + - + @@ -926,6 +939,33 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + @@ -1004,8 +1044,8 @@ - - + + diff --git a/kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin b/kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin new file mode 100644 index 0000000000000000000000000000000000000000..f76dd238ade08917e6712764a16a22005a50573d GIT binary patch literal 1 IcmZPo000310RR91 literal 0 HcmV?d00001 diff --git a/kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock b/kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock new file mode 100644 index 0000000000000000000000000000000000000000..6db3942ed117ec4b2259aa5bd53f7afd006ce4af GIT binary patch literal 17 ScmZQ(Z|7YcQp%Fb00jUZMgnvI literal 0 HcmV?d00001 diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/built.bin b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/built.bin new file mode 100644 index 0000000..e69de29 diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties new file mode 100644 index 0000000..4960bbd --- /dev/null +++ b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties @@ -0,0 +1,2 @@ +#Mon Jun 05 13:06:39 EDT 2017 +gradle.version=3.5 diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock new file mode 100644 index 0000000..40fdece --- /dev/null +++ b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock @@ -0,0 +1 @@ + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/compiler.xml b/kotlin/nucleotide-count/.idea/compiler.xml new file mode 100644 index 0000000..b966427 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/compiler.xml @@ -0,0 +1,9 @@ + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/gradle.xml b/kotlin/nucleotide-count/.idea/gradle.xml new file mode 100644 index 0000000..346dc7e --- /dev/null +++ b/kotlin/nucleotide-count/.idea/gradle.xml @@ -0,0 +1,19 @@ + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml new file mode 100644 index 0000000..04c10dd --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml new file mode 100644 index 0000000..8262f72 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml new file mode 100644 index 0000000..4f32fde --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml new file mode 100644 index 0000000..7b6f562 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml new file mode 100644 index 0000000..1720158 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml new file mode 100644 index 0000000..21c5d19 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml @@ -0,0 +1,11 @@ + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/misc.xml b/kotlin/nucleotide-count/.idea/misc.xml new file mode 100644 index 0000000..3e1805e --- /dev/null +++ b/kotlin/nucleotide-count/.idea/misc.xml @@ -0,0 +1,22 @@ + + + + + + + + + + 1.8 + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/modules.xml b/kotlin/nucleotide-count/.idea/modules.xml new file mode 100644 index 0000000..9577d35 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/modules.xml @@ -0,0 +1,10 @@ + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml new file mode 100644 index 0000000..fdd4f60 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml @@ -0,0 +1,12 @@ + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml new file mode 100644 index 0000000..c5d4e65 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml @@ -0,0 +1,40 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml new file mode 100644 index 0000000..da0b300 --- /dev/null +++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml @@ -0,0 +1,46 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/.idea/workspace.xml b/kotlin/nucleotide-count/.idea/workspace.xml new file mode 100644 index 0000000..ee6defe --- /dev/null +++ b/kotlin/nucleotide-count/.idea/workspace.xml @@ -0,0 +1,1076 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @ignore + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + 1496682396491 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/kotlin/nucleotide-count/README.md b/kotlin/nucleotide-count/README.md new file mode 100644 index 0000000..97cebdf --- /dev/null +++ b/kotlin/nucleotide-count/README.md @@ -0,0 +1,35 @@ +# Nucleotide Count + +Given a DNA string, compute how many times each nucleotide occurs in the string. + +DNA is represented by an alphabet of the following symbols: 'A', 'C', +'G', and 'T'. + +Each symbol represents a nucleotide, which is a fancy name for the +particular molecules that happen to make up a large part of DNA. + +Shortest intro to biochemistry EVAR: + +- twigs are to birds nests as +- nucleotides are to DNA and RNA as +- amino acids are to proteins as +- sugar is to starch as +- oh crap lipids + +I'm not going to talk about lipids because they're crazy complex. + +So back to nucleotides. + +DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine +(`G`), and thymine (`T`). + +RNA contains a slightly different set of nucleotides, but we don't care +about that for now. + +## Source + +The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/) + +## Submitting Incomplete Solutions +It's possible to submit an incomplete solution so you can see how others have completed the exercise. + diff --git a/kotlin/nucleotide-count/build.gradle b/kotlin/nucleotide-count/build.gradle new file mode 100644 index 0000000..16c36c0 --- /dev/null +++ b/kotlin/nucleotide-count/build.gradle @@ -0,0 +1,28 @@ +buildscript { + ext.kotlin_version = '1.1.1' + repositories { + mavenCentral() + } + dependencies { + classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version" + } +} + +apply plugin: 'kotlin' + +repositories { + mavenCentral() +} + +dependencies { + compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version" + + testCompile 'junit:junit:4.12' + testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version" +} +test { + testLogging { + exceptionFormat = 'full' + events = ["passed", "failed", "skipped"] + } +} diff --git a/kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class b/kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class new file mode 100644 index 0000000000000000000000000000000000000000..d0e8581b35a6da9574984c5adaf16c8652fb6709 GIT binary patch literal 3301 zcmb7GYjYb{8Geo~UVF866gNsEo2E{qQd@Q^+c9oxn-EuV62-C;D&x`y8dmZ~T3gz6 zrIliHtARpW?srJJb@&oK76x1!X28Qo7(T#HV1^&TFvUD)wQEbk9m?3+bKdv7_uDyt z`uA^t4`3W`3Y@&WIGeEQg|cBg=8BQF>y}eXj4KcVce87@Q#P&CYNL`eEyt)@dO4NV zEBO_Dy7lZ%-6}YyZPij&yxr(bc2#fask&p9Qw#dK2bOiKm`a!Qs$QV9=_ZYf%usxh zsEhm)=zDj?3PJ*>Th5PAuAoDp!?YUqnjvsvaHvJmjr^)naH!+BkM?bx*3b!6MF0_j zvst@ZOsyJDzN(vaOt&oC(VI>#+RkFVT&9c;r)1U=qXOY9<46HLIMzi0QGp;43VH>4 ziU!I30M{P0C+Ad6t4P)ph^cr8Cz%sBbO*7@886iht6(TNB@pvGcZ>}u)#R6DW{*SeG0Ep~3Xfvc?iWuVM@n0*@W)%h2(nUY@NM z>lMRt<~9n(x{QN@NoI7$v`pusYcK^|z|$(8!j!MlP0CWKYTwoKWoBeXAbv!QSn+OF zD5uk?tUH@TXt*S+>qD3o&>VZA?nn_l5E$^%bx?_3!5+XG(zq;n=h_UBp>;b+!Bys= zp_l8%jXMIT==}o)&}=vj8C+L!4fCx3mWVW)Pr(9-VMPyrE(dHwC&~PTx2M z&oWx;GI1AL%g$@G7CSslt9TEkVF@3JActicFw3cK<_yYfZ&9LH1RurolJJE#GkB!n zW77E6$hDR9ixGSrw*`6+jrY$L=n>>)!G>hPYFI&+L~wRA3(a>mF(*w^P-LC3tLKeP z4W^_mVO5~3z;rCj9B3%ZLcfNJfH3(>3j|C$q$SLRo)}9MEE z5qAM8TDrBFF$JHcwS(@|8)DKztQxmnKBpp#&og!YoLMj&eMNV4N(odNLEbw;emI~5 zc^3rZuqIJKqE^NPM)$U&>fV+bh(6Ar#$PAF=-yUePj9F-kfb(`7I`p&OW)uB!trT3Nw8yYg)!)y^=SoOR_Op zDOtOqmzVXbDPa%UopbcU8UyLUT{*L8=}x^$hUvEIBhCMD>k0Hf%bGANM#gHGHIo`= z53d|1IcL|a1>=e-Ej!T!E*trJac;vgtQyA`U6`{9WxK}fgh4OaE3CJSWf|3US+CU$ zW;pJtSpF{s80D=MX3Ti;N2Br@lL?8=@Er2a2cBU6;l1%_&|Sj_Dv|E`v?X5qiKJ; z)gQguvR^vbzk#0L;i>1}#`GRO_=o%ZZ|&fj9bCx{M`w4C4esE>yLc{$=Z2%{2jHs@ zz)S7$R45+W#Vvtdd_rLH+%5_N_t4;m^K=iTh2fE1tO*=?G!>fCrXs<~a6ClkraIys zu6yU?Iy9-ol*!ImXOn3U*S2B#Ufe^+D`9be|F5y|WOqCg*J9lVhTq?Rby&tWi0|`z zhY{_=W!P9}l=pEGFLBrD?y9IUHUGi@9O4xG1JkGz7slUl5e?i$$lYxar{d3)Wn+^` zF5xfuBt9jxCMNM|e1>{t9i(@aAuzmilBmk;2yZdp|>wJ`IvwZ*WUxCXP?GP zCMgnByNoa)1vv#TE6DRJvFFk4V@obJ-c$>+NlHoc#E~?D5%Fm*iLg}nzeUB4FoI!X z53qXP;40grn=AN~*y3Jx(!)FraE&B~e}m)6;M@4ZFC_(uo2)_nh)@9E!H>EAEw?ax zQ*Dkbb>4lEtI6Dezq_Ii4~z|X$45_aQj8DW_Fjt|daCziX@5lCzU`CDJ8Ckkj-4GF z89zTYre2tM`t10~`Kj>v+8sY?^1bMn(k3X*mw}(quMl6m-^Ne5QyCZ;5U{3x y#&4SNE3CmU-a;^gFS-A(;x!+7od|q6gRkJLw;*cx8oquD;TpbC!#Dl^&i?=_94Qt6 literal 0 HcmV?d00001 diff --git a/kotlin/nucleotide-count/build/classes/main/DNA.class b/kotlin/nucleotide-count/build/classes/main/DNA.class new file mode 100644 index 0000000000000000000000000000000000000000..29099d1ac45b375c9ac70ed74f0854e45e37325c GIT binary patch literal 2717 zcmZuzX;&Ln7=C5~Nf-izv}JXnl-dy52B=spSfv4MN?3%7rKs%?E@5CY!I=rRbwiKG zKj1&`lOO!x)|T3%hr>sIl*i{zCR-_Ia@Tix-u3eDe}DZ0U=-ge2uv?bg`g;i?&$k^ z($uY7a&covWZe(~3c9Ug))WQT*c7Qk(Q=)EO<{_h?g|AhncaeG8dfr+KYBQ!;9RC) z=aM_Z-LQ4Ta+11b69A{a!X8J!ra%any;enWz}M3)*?*`icXBx=wESd!^+X4t#wI4s`@DTbP@ z%W$tVS87f42?tlh7*p_?p9VYo`6ST_+tSS>y+);uk##~KduMiAWOtVsth^va+VL}2 z!G&7ECw*5@6~TL$((o>Bu)5-ds}W3KT0;Y77%?WyK-GM|q((z{pI(Z4=~QA!Yq*J9 z^^muUR<=}4v;Jy0gbWk3CcEcYwhPQelO?Gj886p|H2Ed`6N6;}uZAO7!Uq}_u}nCV zS=P4a()KdZym0kR-PIW(HNPKV4^iY03Zj({}@#vsmQ@d16jUF9n{M2Zx zriSJIJbw}X!rV7?9UY9S!^(}8STL&gsKbHdpMq+%;Z|$3jl1w@FdF3?TD}l%>}icP z#JKjx@NjT^_RjGS$KR{uh-eMr=4hm+A>0(zmfI_m!qm*emT2qo&%t&HZB!v_L|=>o zGpBlV$*bsldG;}usPEqsJtl+=1&Nm>Rk;f-i!EUbD=S9Q`8_j)&H9K|l8|(=eX&)B zz^2gQRc*=^?6Y%Tk4>4n!!k(J=Ad_0jbH^{={$mM7#ece3FE$kfx3z+C0@DnReEk1 zc?I*8q^U@p7Fm-OA@QXOmP@Y)yS8umxqq^fOUYc&Ah4&PX|L3~A2K^;Dq8BQ@ucHk zVqlqQgsskoBaLKl3$nH@?{d+*%x-MtMcUdo9Am>2Q`LuvrI9LZvhBw*g{*F_>b9Yi z;wa2%W!@M8QLj z5zgQ<(S>f#kN8vZMV-=i^q`kiQf!9eRnA?BCwR5@5a$Aih(E){0EJ$Dg3(_*ekr%3 zMCZ#T2d>~vO8Js^(j4Fn0bj*9>7?W&&*W(%0bi5w)Ean=zL+X=yU)wWO7bK`V6+EwR#9Ud?JleItGTH76~R(MHaVTpYb}ZA44VXgHt@jX-X4mX7|G z;|}*9GACBo5lG`B@4JJw^6oAVur7y>*P%H01fQ-W=AhfbJqKgnIO*WNx8MoCu!ANC SjShkit~wZZ(Bt5W1O0!!r=wc{ literal 0 HcmV?d00001 diff --git a/kotlin/nucleotide-count/build/classes/test/NucleotideTest.class b/kotlin/nucleotide-count/build/classes/test/NucleotideTest.class new file mode 100644 index 0000000000000000000000000000000000000000..8e8290ba9248cad54689c761fccc046370ffb174 GIT binary patch literal 3219 zcmbW2`%@EF6vw|ekYrtgF3;lI3Rn;|KC0GY)pe0I8bDzMf%;gIOIX}&Vs^vGZ~h1U zA3E(!f9v!YW!h=S@yGsAot}F)Y&OBR)(y$t$GPY6Ip}Tj{ z?&rLKmv}7=jUl~dyLCRd&M-KZ8;>bz2u)_ti#`=S=x0b4Ds?Yl=o~Y~a~TZcGogHl zVdzCAa2+ojke6BA_jxUFDxQCzf<460Z_AZCFYC7Jj}-a3U3W=KKJIhKW-{i$-jzmN zxxGRn)FU{m;xLX8q@rh&vw31g$U1`!#}_bLlS4blK9Gc_5S{62g!RC7h}I}WUlXFS zVb|a2Rz@LM`#23BwSH zCn7y#d(V7@YoZLkW>EO6Dw*d+iZ!GWsb)A@<5eCwfwRSpZE6uJbdv|Z)GSUU4e=32IHXa4H$zNHUzL2ptw#!mKL$?&Mbe&Y2rh+@f zDiqY4!HF|-WP<`QOx?2RjDouir>Ty@z^5v+m4K4!mAJl6IhU){x3QK@i<7#cE4WV; zPhI5{ZEA<66{0s1E0G*!s${!*tyC{_FSzrnz^fv0RF?_!v4T0O&kt#lrgL7kF8a{a z4NJj18EgdQx-AB$bEutA7*c7ELd@gTw&^5@!Pl~2%ata3af@Z}F4Bx$b-LEEw5^6$w_gYOT zVnAO-9eVfrV&XizoqYd&ik9vvTF0Tp`Odp(8YQDqDjKDukrIveMI$vDbw#60H0lmV z?|(|sm6#|}Zwz?Roqbk9d{(v{kAiH16nF2r7lOA@DN>d6<|_r;U9@YCz2^JON?(KR@COUR7Frn#haF7Np&31777m`R|oqh-Dt)d?%@Hug(b2y1%dY9ECf`xkJ-;Fd@wE;KIUkr)I>bNzIH; zQ<@cH`>XFSK8^l&6F+bS3Tr%?h6xk?id|9TVP7u& zOR4uorM?seVaI|PB*#E9DmBC`ZsHMc;W_lSKxU#qu2BOqI?*Kqc|d_IHE)AVxD`{c z%G+d`)SFUem+XIr>jkpbgNKpc8x6gh)Vn}>wZ|em?aH-1%JVpYnGY$qBIQ3d=s%Up z7u)D-{kyzF{90yr9`e_EcIRONG{PTc;2+V?$6CgU&_9j2AKo(a#AX5W1pWyYTd*_I zAnr?XFK6j3uqRKy#p8A+$(T}cfW!#9L+=ENQl(9+%e1<(ijEvs<=?k>vO9Z93wS1e rp09%Wu(7s^13rd*s6J9YOgXT8O!>IyBk5zr#| by lazy { + for (i in nucleotides){ + print(i) + if (!((i == 'A') or (i == 'C') or (i == 'G') or (i == 'T'))) throw IllegalArgumentException() + } + var tempMap: MutableMap = emptyMap().toMutableMap() + tempMap.put('A', 0) + tempMap.put('C', 0) + tempMap.put('G', 0) + tempMap.put('T', 0) + + for (i in tempMap){ + tempMap.put(i.key, nucleotides.count { it == i.key }) + } + + tempMap + } + + fun count(testChar: Char): Int{ + return nucleotideCounts.getOrDefault(testChar, 0) + } +} \ No newline at end of file diff --git a/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt b/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt new file mode 100644 index 0000000..80b4ccc --- /dev/null +++ b/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt @@ -0,0 +1,87 @@ +import org.junit.Test +import org.junit.Ignore; +import kotlin.test.assertEquals + +class NucleotideTest { + + + @Test + fun emptyDnaStringHasNoAdenosine() { + val dna = DNA(""); + + assertEquals(0, dna.count('A')) + } + + + @Test + fun emptyDnaStringHasNoNucleotides() { + val dna = DNA(""); + val expected = mapOf('A' to 0, 'C' to 0, 'G' to 0, 'T' to 0) + + assertEquals(expected, dna.nucleotideCounts) + } + + + @Test + fun repetitiveCytidineGetsCounted() { + val dna = DNA("CCCCC"); + assertEquals(5, dna.count('C')) + } + + + @Test + fun repetitiveSequenceWithOnlyGuanosine() { + val dna = DNA("GGGGGGGG"); + val expected = mapOf('A' to 0, 'C' to 0, 'G' to 8, 'T' to 0) + + assertEquals(expected, dna.nucleotideCounts) + } + + + @Test + fun countsOnlyThymidine() { + val dna = DNA("GGGGGTAACCCGG"); + + assertEquals(1, dna.count('T')) + } + + + @Test + fun countsANucleotideOnlyOnce() { + val dna = DNA("CGATTGGG"); + + dna.count('T') + assertEquals(2, dna.count('T')) + } + + + @Test + fun dnaCountsDoNotChangeAfterCountingAdenosine() { + val dna = DNA("GATTACA"); + val expected = mapOf('A' to 3, 'C' to 1, 'G' to 1, 'T' to 2) + + dna.count('A'); + assertEquals(expected, dna.nucleotideCounts) + } + + + @Test(expected = IllegalArgumentException::class) + fun validatesNucleotides() { + DNA("GX") + } + + + @Test(expected = IllegalArgumentException::class) + fun validatesNucleotidesCountInput() { + DNA("GACT").count('X'); + } + + + @Test + fun countsAllNucleotides() { + val dna = DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") + val expected = mapOf('A' to 20, 'C' to 12, 'G' to 17, 'T' to 21) + + assertEquals(expected, dna.nucleotideCounts) + } +} diff --git a/kotlin/space-age/.idea/workspace.xml b/kotlin/space-age/.idea/workspace.xml index 6120b39..e12f037 100644 --- a/kotlin/space-age/.idea/workspace.xml +++ b/kotlin/space-age/.idea/workspace.xml @@ -35,7 +35,7 @@ - + @@ -484,7 +484,7 @@ - + - +