+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/beer-song/README.md b/kotlin/beer-song/README.md
new file mode 100644
index 0000000..2bf06c3
--- /dev/null
+++ b/kotlin/beer-song/README.md
@@ -0,0 +1,329 @@
+# Beer Song
+
+Produce the lyrics to that beloved classic, that field-trip favorite: 99 Bottles of Beer on the Wall.
+
+Note that not all verses are identical.
+
+```plain
+99 bottles of beer on the wall, 99 bottles of beer.
+Take one down and pass it around, 98 bottles of beer on the wall.
+
+98 bottles of beer on the wall, 98 bottles of beer.
+Take one down and pass it around, 97 bottles of beer on the wall.
+
+97 bottles of beer on the wall, 97 bottles of beer.
+Take one down and pass it around, 96 bottles of beer on the wall.
+
+96 bottles of beer on the wall, 96 bottles of beer.
+Take one down and pass it around, 95 bottles of beer on the wall.
+
+95 bottles of beer on the wall, 95 bottles of beer.
+Take one down and pass it around, 94 bottles of beer on the wall.
+
+94 bottles of beer on the wall, 94 bottles of beer.
+Take one down and pass it around, 93 bottles of beer on the wall.
+
+93 bottles of beer on the wall, 93 bottles of beer.
+Take one down and pass it around, 92 bottles of beer on the wall.
+
+92 bottles of beer on the wall, 92 bottles of beer.
+Take one down and pass it around, 91 bottles of beer on the wall.
+
+91 bottles of beer on the wall, 91 bottles of beer.
+Take one down and pass it around, 90 bottles of beer on the wall.
+
+90 bottles of beer on the wall, 90 bottles of beer.
+Take one down and pass it around, 89 bottles of beer on the wall.
+
+89 bottles of beer on the wall, 89 bottles of beer.
+Take one down and pass it around, 88 bottles of beer on the wall.
+
+88 bottles of beer on the wall, 88 bottles of beer.
+Take one down and pass it around, 87 bottles of beer on the wall.
+
+87 bottles of beer on the wall, 87 bottles of beer.
+Take one down and pass it around, 86 bottles of beer on the wall.
+
+86 bottles of beer on the wall, 86 bottles of beer.
+Take one down and pass it around, 85 bottles of beer on the wall.
+
+85 bottles of beer on the wall, 85 bottles of beer.
+Take one down and pass it around, 84 bottles of beer on the wall.
+
+84 bottles of beer on the wall, 84 bottles of beer.
+Take one down and pass it around, 83 bottles of beer on the wall.
+
+83 bottles of beer on the wall, 83 bottles of beer.
+Take one down and pass it around, 82 bottles of beer on the wall.
+
+82 bottles of beer on the wall, 82 bottles of beer.
+Take one down and pass it around, 81 bottles of beer on the wall.
+
+81 bottles of beer on the wall, 81 bottles of beer.
+Take one down and pass it around, 80 bottles of beer on the wall.
+
+80 bottles of beer on the wall, 80 bottles of beer.
+Take one down and pass it around, 79 bottles of beer on the wall.
+
+79 bottles of beer on the wall, 79 bottles of beer.
+Take one down and pass it around, 78 bottles of beer on the wall.
+
+78 bottles of beer on the wall, 78 bottles of beer.
+Take one down and pass it around, 77 bottles of beer on the wall.
+
+77 bottles of beer on the wall, 77 bottles of beer.
+Take one down and pass it around, 76 bottles of beer on the wall.
+
+76 bottles of beer on the wall, 76 bottles of beer.
+Take one down and pass it around, 75 bottles of beer on the wall.
+
+75 bottles of beer on the wall, 75 bottles of beer.
+Take one down and pass it around, 74 bottles of beer on the wall.
+
+74 bottles of beer on the wall, 74 bottles of beer.
+Take one down and pass it around, 73 bottles of beer on the wall.
+
+73 bottles of beer on the wall, 73 bottles of beer.
+Take one down and pass it around, 72 bottles of beer on the wall.
+
+72 bottles of beer on the wall, 72 bottles of beer.
+Take one down and pass it around, 71 bottles of beer on the wall.
+
+71 bottles of beer on the wall, 71 bottles of beer.
+Take one down and pass it around, 70 bottles of beer on the wall.
+
+70 bottles of beer on the wall, 70 bottles of beer.
+Take one down and pass it around, 69 bottles of beer on the wall.
+
+69 bottles of beer on the wall, 69 bottles of beer.
+Take one down and pass it around, 68 bottles of beer on the wall.
+
+68 bottles of beer on the wall, 68 bottles of beer.
+Take one down and pass it around, 67 bottles of beer on the wall.
+
+67 bottles of beer on the wall, 67 bottles of beer.
+Take one down and pass it around, 66 bottles of beer on the wall.
+
+66 bottles of beer on the wall, 66 bottles of beer.
+Take one down and pass it around, 65 bottles of beer on the wall.
+
+65 bottles of beer on the wall, 65 bottles of beer.
+Take one down and pass it around, 64 bottles of beer on the wall.
+
+64 bottles of beer on the wall, 64 bottles of beer.
+Take one down and pass it around, 63 bottles of beer on the wall.
+
+63 bottles of beer on the wall, 63 bottles of beer.
+Take one down and pass it around, 62 bottles of beer on the wall.
+
+62 bottles of beer on the wall, 62 bottles of beer.
+Take one down and pass it around, 61 bottles of beer on the wall.
+
+61 bottles of beer on the wall, 61 bottles of beer.
+Take one down and pass it around, 60 bottles of beer on the wall.
+
+60 bottles of beer on the wall, 60 bottles of beer.
+Take one down and pass it around, 59 bottles of beer on the wall.
+
+59 bottles of beer on the wall, 59 bottles of beer.
+Take one down and pass it around, 58 bottles of beer on the wall.
+
+58 bottles of beer on the wall, 58 bottles of beer.
+Take one down and pass it around, 57 bottles of beer on the wall.
+
+57 bottles of beer on the wall, 57 bottles of beer.
+Take one down and pass it around, 56 bottles of beer on the wall.
+
+56 bottles of beer on the wall, 56 bottles of beer.
+Take one down and pass it around, 55 bottles of beer on the wall.
+
+55 bottles of beer on the wall, 55 bottles of beer.
+Take one down and pass it around, 54 bottles of beer on the wall.
+
+54 bottles of beer on the wall, 54 bottles of beer.
+Take one down and pass it around, 53 bottles of beer on the wall.
+
+53 bottles of beer on the wall, 53 bottles of beer.
+Take one down and pass it around, 52 bottles of beer on the wall.
+
+52 bottles of beer on the wall, 52 bottles of beer.
+Take one down and pass it around, 51 bottles of beer on the wall.
+
+51 bottles of beer on the wall, 51 bottles of beer.
+Take one down and pass it around, 50 bottles of beer on the wall.
+
+50 bottles of beer on the wall, 50 bottles of beer.
+Take one down and pass it around, 49 bottles of beer on the wall.
+
+49 bottles of beer on the wall, 49 bottles of beer.
+Take one down and pass it around, 48 bottles of beer on the wall.
+
+48 bottles of beer on the wall, 48 bottles of beer.
+Take one down and pass it around, 47 bottles of beer on the wall.
+
+47 bottles of beer on the wall, 47 bottles of beer.
+Take one down and pass it around, 46 bottles of beer on the wall.
+
+46 bottles of beer on the wall, 46 bottles of beer.
+Take one down and pass it around, 45 bottles of beer on the wall.
+
+45 bottles of beer on the wall, 45 bottles of beer.
+Take one down and pass it around, 44 bottles of beer on the wall.
+
+44 bottles of beer on the wall, 44 bottles of beer.
+Take one down and pass it around, 43 bottles of beer on the wall.
+
+43 bottles of beer on the wall, 43 bottles of beer.
+Take one down and pass it around, 42 bottles of beer on the wall.
+
+42 bottles of beer on the wall, 42 bottles of beer.
+Take one down and pass it around, 41 bottles of beer on the wall.
+
+41 bottles of beer on the wall, 41 bottles of beer.
+Take one down and pass it around, 40 bottles of beer on the wall.
+
+40 bottles of beer on the wall, 40 bottles of beer.
+Take one down and pass it around, 39 bottles of beer on the wall.
+
+39 bottles of beer on the wall, 39 bottles of beer.
+Take one down and pass it around, 38 bottles of beer on the wall.
+
+38 bottles of beer on the wall, 38 bottles of beer.
+Take one down and pass it around, 37 bottles of beer on the wall.
+
+37 bottles of beer on the wall, 37 bottles of beer.
+Take one down and pass it around, 36 bottles of beer on the wall.
+
+36 bottles of beer on the wall, 36 bottles of beer.
+Take one down and pass it around, 35 bottles of beer on the wall.
+
+35 bottles of beer on the wall, 35 bottles of beer.
+Take one down and pass it around, 34 bottles of beer on the wall.
+
+34 bottles of beer on the wall, 34 bottles of beer.
+Take one down and pass it around, 33 bottles of beer on the wall.
+
+33 bottles of beer on the wall, 33 bottles of beer.
+Take one down and pass it around, 32 bottles of beer on the wall.
+
+32 bottles of beer on the wall, 32 bottles of beer.
+Take one down and pass it around, 31 bottles of beer on the wall.
+
+31 bottles of beer on the wall, 31 bottles of beer.
+Take one down and pass it around, 30 bottles of beer on the wall.
+
+30 bottles of beer on the wall, 30 bottles of beer.
+Take one down and pass it around, 29 bottles of beer on the wall.
+
+29 bottles of beer on the wall, 29 bottles of beer.
+Take one down and pass it around, 28 bottles of beer on the wall.
+
+28 bottles of beer on the wall, 28 bottles of beer.
+Take one down and pass it around, 27 bottles of beer on the wall.
+
+27 bottles of beer on the wall, 27 bottles of beer.
+Take one down and pass it around, 26 bottles of beer on the wall.
+
+26 bottles of beer on the wall, 26 bottles of beer.
+Take one down and pass it around, 25 bottles of beer on the wall.
+
+25 bottles of beer on the wall, 25 bottles of beer.
+Take one down and pass it around, 24 bottles of beer on the wall.
+
+24 bottles of beer on the wall, 24 bottles of beer.
+Take one down and pass it around, 23 bottles of beer on the wall.
+
+23 bottles of beer on the wall, 23 bottles of beer.
+Take one down and pass it around, 22 bottles of beer on the wall.
+
+22 bottles of beer on the wall, 22 bottles of beer.
+Take one down and pass it around, 21 bottles of beer on the wall.
+
+21 bottles of beer on the wall, 21 bottles of beer.
+Take one down and pass it around, 20 bottles of beer on the wall.
+
+20 bottles of beer on the wall, 20 bottles of beer.
+Take one down and pass it around, 19 bottles of beer on the wall.
+
+19 bottles of beer on the wall, 19 bottles of beer.
+Take one down and pass it around, 18 bottles of beer on the wall.
+
+18 bottles of beer on the wall, 18 bottles of beer.
+Take one down and pass it around, 17 bottles of beer on the wall.
+
+17 bottles of beer on the wall, 17 bottles of beer.
+Take one down and pass it around, 16 bottles of beer on the wall.
+
+16 bottles of beer on the wall, 16 bottles of beer.
+Take one down and pass it around, 15 bottles of beer on the wall.
+
+15 bottles of beer on the wall, 15 bottles of beer.
+Take one down and pass it around, 14 bottles of beer on the wall.
+
+14 bottles of beer on the wall, 14 bottles of beer.
+Take one down and pass it around, 13 bottles of beer on the wall.
+
+13 bottles of beer on the wall, 13 bottles of beer.
+Take one down and pass it around, 12 bottles of beer on the wall.
+
+12 bottles of beer on the wall, 12 bottles of beer.
+Take one down and pass it around, 11 bottles of beer on the wall.
+
+11 bottles of beer on the wall, 11 bottles of beer.
+Take one down and pass it around, 10 bottles of beer on the wall.
+
+10 bottles of beer on the wall, 10 bottles of beer.
+Take one down and pass it around, 9 bottles of beer on the wall.
+
+9 bottles of beer on the wall, 9 bottles of beer.
+Take one down and pass it around, 8 bottles of beer on the wall.
+
+8 bottles of beer on the wall, 8 bottles of beer.
+Take one down and pass it around, 7 bottles of beer on the wall.
+
+7 bottles of beer on the wall, 7 bottles of beer.
+Take one down and pass it around, 6 bottles of beer on the wall.
+
+6 bottles of beer on the wall, 6 bottles of beer.
+Take one down and pass it around, 5 bottles of beer on the wall.
+
+5 bottles of beer on the wall, 5 bottles of beer.
+Take one down and pass it around, 4 bottles of beer on the wall.
+
+4 bottles of beer on the wall, 4 bottles of beer.
+Take one down and pass it around, 3 bottles of beer on the wall.
+
+3 bottles of beer on the wall, 3 bottles of beer.
+Take one down and pass it around, 2 bottles of beer on the wall.
+
+2 bottles of beer on the wall, 2 bottles of beer.
+Take one down and pass it around, 1 bottle of beer on the wall.
+
+1 bottle of beer on the wall, 1 bottle of beer.
+Take it down and pass it around, no more bottles of beer on the wall.
+
+No more bottles of beer on the wall, no more bottles of beer.
+Go to the store and buy some more, 99 bottles of beer on the wall.
+```
+
+## For bonus points
+
+Did you get the tests passing and the code clean? If you want to, these
+are some additional things you could try:
+
+* Remove as much duplication as you possibly can.
+* Optimize for readability, even if it means introducing duplication.
+* If you've removed all the duplication, do you have a lot of
+ conditionals? Try replacing the conditionals with polymorphism, if it
+ applies in this language. How readable is it?
+
+Then please share your thoughts in a comment on the submission. Did this
+experiment make the code better? Worse? Did you learn anything from it?
+
+## Source
+
+Learn to Program by Chris Pine [http://pine.fm/LearnToProgram/?Chapter=06](http://pine.fm/LearnToProgram/?Chapter=06)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+
diff --git a/kotlin/beer-song/beer-song.iml b/kotlin/beer-song/beer-song.iml
new file mode 100644
index 0000000..9291a89
--- /dev/null
+++ b/kotlin/beer-song/beer-song.iml
@@ -0,0 +1,12 @@
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/beer-song/build.gradle b/kotlin/beer-song/build.gradle
new file mode 100644
index 0000000..16c36c0
--- /dev/null
+++ b/kotlin/beer-song/build.gradle
@@ -0,0 +1,28 @@
+buildscript {
+ ext.kotlin_version = '1.1.1'
+ repositories {
+ mavenCentral()
+ }
+ dependencies {
+ classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version"
+ }
+}
+
+apply plugin: 'kotlin'
+
+repositories {
+ mavenCentral()
+}
+
+dependencies {
+ compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version"
+
+ testCompile 'junit:junit:4.12'
+ testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version"
+}
+test {
+ testLogging {
+ exceptionFormat = 'full'
+ events = ["passed", "failed", "skipped"]
+ }
+}
diff --git a/kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class b/kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class
new file mode 100644
index 0000000..6a38001
Binary files /dev/null and b/kotlin/beer-song/build/classes/main/BeerSong$lyrics$2.class differ
diff --git a/kotlin/beer-song/build/classes/main/BeerSong.class b/kotlin/beer-song/build/classes/main/BeerSong.class
new file mode 100644
index 0000000..23f0002
Binary files /dev/null and b/kotlin/beer-song/build/classes/main/BeerSong.class differ
diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class
new file mode 100644
index 0000000..bc98135
Binary files /dev/null and b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse100To98$1.class differ
diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class
new file mode 100644
index 0000000..fa3a3a5
Binary files /dev/null and b/kotlin/beer-song/build/classes/test/BeerSongTest$songVerse3ToMinus1$1.class differ
diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$verse100$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$verse100$1.class
new file mode 100644
index 0000000..1f60009
Binary files /dev/null and b/kotlin/beer-song/build/classes/test/BeerSongTest$verse100$1.class differ
diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class b/kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class
new file mode 100644
index 0000000..c6cd93e
Binary files /dev/null and b/kotlin/beer-song/build/classes/test/BeerSongTest$verseMinus1$1.class differ
diff --git a/kotlin/beer-song/build/classes/test/BeerSongTest.class b/kotlin/beer-song/build/classes/test/BeerSongTest.class
new file mode 100644
index 0000000..3ae2d38
Binary files /dev/null and b/kotlin/beer-song/build/classes/test/BeerSongTest.class differ
diff --git a/kotlin/beer-song/build/kotlin-build/caches/version.txt b/kotlin/beer-song/build/kotlin-build/caches/version.txt
new file mode 100644
index 0000000..01aabac
--- /dev/null
+++ b/kotlin/beer-song/build/kotlin-build/caches/version.txt
@@ -0,0 +1 @@
+11001
\ No newline at end of file
diff --git a/kotlin/beer-song/src/main/kotlin/.keep b/kotlin/beer-song/src/main/kotlin/.keep
new file mode 100644
index 0000000..e69de29
diff --git a/kotlin/beer-song/src/main/kotlin/BeerSong.kt b/kotlin/beer-song/src/main/kotlin/BeerSong.kt
new file mode 100644
index 0000000..86e3a7e
--- /dev/null
+++ b/kotlin/beer-song/src/main/kotlin/BeerSong.kt
@@ -0,0 +1,18 @@
+object BeerSong {
+ val lyrics: String by lazy {
+ verses(99, 0)
+ }
+ fun verse(verseNumber: Int): String{
+ if (verseNumber < 0 || verseNumber > 99) throw IllegalArgumentException()
+ when (verseNumber){
+ 0 -> return "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
+ 1 -> return "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n"
+ 2 -> return "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n"
+ else -> return "${verseNumber} bottles of beer on the wall, ${verseNumber} bottles of beer.\nTake one down and pass it around, ${verseNumber -1} bottles of beer on the wall.\n"
+ }
+ }
+
+ fun verses(firstVerse: Int, lastVerse: Int): String{
+ return (IntRange(lastVerse, firstVerse).reversed()).map { verse(it) }.fold("", {acc, s -> acc + s + "\n" }).dropLast(1)
+ }
+}
\ No newline at end of file
diff --git a/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt b/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt
new file mode 100644
index 0000000..9bdf971
--- /dev/null
+++ b/kotlin/beer-song/src/test/kotlin/BeerSongTest.kt
@@ -0,0 +1,386 @@
+import org.junit.Test
+import org.junit.Ignore
+import kotlin.test.assertEquals
+import kotlin.test.assertFailsWith
+
+class BeerSongTest {
+
+
+ @Test
+ fun verse0() {
+ val expected = "No more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verse(0))
+ }
+
+
+ @Test
+ fun verse1() {
+ val expected = "1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verse(1))
+ }
+
+
+ @Test
+ fun verse2() {
+ val expected = "2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verse(2))
+ }
+
+
+ @Test
+ fun verse8() {
+ val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verse(8))
+ }
+
+
+ @Test
+ fun verse99() {
+ val expected = "99 bottles of beer on the wall, 99 bottles of beer.\nTake one down and pass it around, 98 bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verse(99))
+ }
+
+
+ @Test
+ fun verseMinus1() {
+ assertFailsWith(IllegalArgumentException::class, "Beer song verse can't be negative", { BeerSong.verse(-1) })
+ }
+
+
+ @Test
+ fun verse100() {
+ assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verse(100) })
+ }
+
+ @Test
+ fun songVerse8To6() {
+ val expected = "8 bottles of beer on the wall, 8 bottles of beer.\nTake one down and pass it around, 7 bottles of beer on the wall.\n\n7 bottles of beer on the wall, 7 bottles of beer.\nTake one down and pass it around, 6 bottles of beer on the wall.\n\n6 bottles of beer on the wall, 6 bottles of beer.\nTake one down and pass it around, 5 bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verses(8, 6))
+ }
+
+
+ @Test
+ fun songVerse3To0() {
+ val expected = "3 bottles of beer on the wall, 3 bottles of beer.\nTake one down and pass it around, 2 bottles of beer on the wall.\n\n2 bottles of beer on the wall, 2 bottles of beer.\nTake one down and pass it around, 1 bottle of beer on the wall.\n\n1 bottle of beer on the wall, 1 bottle of beer.\nTake it down and pass it around, no more bottles of beer on the wall.\n\nNo more bottles of beer on the wall, no more bottles of beer.\nGo to the store and buy some more, 99 bottles of beer on the wall.\n"
+ assertEquals(expected, BeerSong.verses(3, 0))
+ }
+
+
+ @Test
+ fun songVerse100To98() {
+ assertFailsWith(IllegalArgumentException::class, "Beer song only goes up to verse 99", { BeerSong.verses(100, 98) })
+ }
+
+
+ @Test
+ fun songVerse3ToMinus1() {
+ assertFailsWith(IllegalArgumentException::class, "Beer song can't go down into a negative verse", { BeerSong.verses(3, -1) })
+ }
+
+
+ @Test
+ fun entireSong() {
+ val expected =
+ """99 bottles of beer on the wall, 99 bottles of beer.
+Take one down and pass it around, 98 bottles of beer on the wall.
+
+98 bottles of beer on the wall, 98 bottles of beer.
+Take one down and pass it around, 97 bottles of beer on the wall.
+
+97 bottles of beer on the wall, 97 bottles of beer.
+Take one down and pass it around, 96 bottles of beer on the wall.
+
+96 bottles of beer on the wall, 96 bottles of beer.
+Take one down and pass it around, 95 bottles of beer on the wall.
+
+95 bottles of beer on the wall, 95 bottles of beer.
+Take one down and pass it around, 94 bottles of beer on the wall.
+
+94 bottles of beer on the wall, 94 bottles of beer.
+Take one down and pass it around, 93 bottles of beer on the wall.
+
+93 bottles of beer on the wall, 93 bottles of beer.
+Take one down and pass it around, 92 bottles of beer on the wall.
+
+92 bottles of beer on the wall, 92 bottles of beer.
+Take one down and pass it around, 91 bottles of beer on the wall.
+
+91 bottles of beer on the wall, 91 bottles of beer.
+Take one down and pass it around, 90 bottles of beer on the wall.
+
+90 bottles of beer on the wall, 90 bottles of beer.
+Take one down and pass it around, 89 bottles of beer on the wall.
+
+89 bottles of beer on the wall, 89 bottles of beer.
+Take one down and pass it around, 88 bottles of beer on the wall.
+
+88 bottles of beer on the wall, 88 bottles of beer.
+Take one down and pass it around, 87 bottles of beer on the wall.
+
+87 bottles of beer on the wall, 87 bottles of beer.
+Take one down and pass it around, 86 bottles of beer on the wall.
+
+86 bottles of beer on the wall, 86 bottles of beer.
+Take one down and pass it around, 85 bottles of beer on the wall.
+
+85 bottles of beer on the wall, 85 bottles of beer.
+Take one down and pass it around, 84 bottles of beer on the wall.
+
+84 bottles of beer on the wall, 84 bottles of beer.
+Take one down and pass it around, 83 bottles of beer on the wall.
+
+83 bottles of beer on the wall, 83 bottles of beer.
+Take one down and pass it around, 82 bottles of beer on the wall.
+
+82 bottles of beer on the wall, 82 bottles of beer.
+Take one down and pass it around, 81 bottles of beer on the wall.
+
+81 bottles of beer on the wall, 81 bottles of beer.
+Take one down and pass it around, 80 bottles of beer on the wall.
+
+80 bottles of beer on the wall, 80 bottles of beer.
+Take one down and pass it around, 79 bottles of beer on the wall.
+
+79 bottles of beer on the wall, 79 bottles of beer.
+Take one down and pass it around, 78 bottles of beer on the wall.
+
+78 bottles of beer on the wall, 78 bottles of beer.
+Take one down and pass it around, 77 bottles of beer on the wall.
+
+77 bottles of beer on the wall, 77 bottles of beer.
+Take one down and pass it around, 76 bottles of beer on the wall.
+
+76 bottles of beer on the wall, 76 bottles of beer.
+Take one down and pass it around, 75 bottles of beer on the wall.
+
+75 bottles of beer on the wall, 75 bottles of beer.
+Take one down and pass it around, 74 bottles of beer on the wall.
+
+74 bottles of beer on the wall, 74 bottles of beer.
+Take one down and pass it around, 73 bottles of beer on the wall.
+
+73 bottles of beer on the wall, 73 bottles of beer.
+Take one down and pass it around, 72 bottles of beer on the wall.
+
+72 bottles of beer on the wall, 72 bottles of beer.
+Take one down and pass it around, 71 bottles of beer on the wall.
+
+71 bottles of beer on the wall, 71 bottles of beer.
+Take one down and pass it around, 70 bottles of beer on the wall.
+
+70 bottles of beer on the wall, 70 bottles of beer.
+Take one down and pass it around, 69 bottles of beer on the wall.
+
+69 bottles of beer on the wall, 69 bottles of beer.
+Take one down and pass it around, 68 bottles of beer on the wall.
+
+68 bottles of beer on the wall, 68 bottles of beer.
+Take one down and pass it around, 67 bottles of beer on the wall.
+
+67 bottles of beer on the wall, 67 bottles of beer.
+Take one down and pass it around, 66 bottles of beer on the wall.
+
+66 bottles of beer on the wall, 66 bottles of beer.
+Take one down and pass it around, 65 bottles of beer on the wall.
+
+65 bottles of beer on the wall, 65 bottles of beer.
+Take one down and pass it around, 64 bottles of beer on the wall.
+
+64 bottles of beer on the wall, 64 bottles of beer.
+Take one down and pass it around, 63 bottles of beer on the wall.
+
+63 bottles of beer on the wall, 63 bottles of beer.
+Take one down and pass it around, 62 bottles of beer on the wall.
+
+62 bottles of beer on the wall, 62 bottles of beer.
+Take one down and pass it around, 61 bottles of beer on the wall.
+
+61 bottles of beer on the wall, 61 bottles of beer.
+Take one down and pass it around, 60 bottles of beer on the wall.
+
+60 bottles of beer on the wall, 60 bottles of beer.
+Take one down and pass it around, 59 bottles of beer on the wall.
+
+59 bottles of beer on the wall, 59 bottles of beer.
+Take one down and pass it around, 58 bottles of beer on the wall.
+
+58 bottles of beer on the wall, 58 bottles of beer.
+Take one down and pass it around, 57 bottles of beer on the wall.
+
+57 bottles of beer on the wall, 57 bottles of beer.
+Take one down and pass it around, 56 bottles of beer on the wall.
+
+56 bottles of beer on the wall, 56 bottles of beer.
+Take one down and pass it around, 55 bottles of beer on the wall.
+
+55 bottles of beer on the wall, 55 bottles of beer.
+Take one down and pass it around, 54 bottles of beer on the wall.
+
+54 bottles of beer on the wall, 54 bottles of beer.
+Take one down and pass it around, 53 bottles of beer on the wall.
+
+53 bottles of beer on the wall, 53 bottles of beer.
+Take one down and pass it around, 52 bottles of beer on the wall.
+
+52 bottles of beer on the wall, 52 bottles of beer.
+Take one down and pass it around, 51 bottles of beer on the wall.
+
+51 bottles of beer on the wall, 51 bottles of beer.
+Take one down and pass it around, 50 bottles of beer on the wall.
+
+50 bottles of beer on the wall, 50 bottles of beer.
+Take one down and pass it around, 49 bottles of beer on the wall.
+
+49 bottles of beer on the wall, 49 bottles of beer.
+Take one down and pass it around, 48 bottles of beer on the wall.
+
+48 bottles of beer on the wall, 48 bottles of beer.
+Take one down and pass it around, 47 bottles of beer on the wall.
+
+47 bottles of beer on the wall, 47 bottles of beer.
+Take one down and pass it around, 46 bottles of beer on the wall.
+
+46 bottles of beer on the wall, 46 bottles of beer.
+Take one down and pass it around, 45 bottles of beer on the wall.
+
+45 bottles of beer on the wall, 45 bottles of beer.
+Take one down and pass it around, 44 bottles of beer on the wall.
+
+44 bottles of beer on the wall, 44 bottles of beer.
+Take one down and pass it around, 43 bottles of beer on the wall.
+
+43 bottles of beer on the wall, 43 bottles of beer.
+Take one down and pass it around, 42 bottles of beer on the wall.
+
+42 bottles of beer on the wall, 42 bottles of beer.
+Take one down and pass it around, 41 bottles of beer on the wall.
+
+41 bottles of beer on the wall, 41 bottles of beer.
+Take one down and pass it around, 40 bottles of beer on the wall.
+
+40 bottles of beer on the wall, 40 bottles of beer.
+Take one down and pass it around, 39 bottles of beer on the wall.
+
+39 bottles of beer on the wall, 39 bottles of beer.
+Take one down and pass it around, 38 bottles of beer on the wall.
+
+38 bottles of beer on the wall, 38 bottles of beer.
+Take one down and pass it around, 37 bottles of beer on the wall.
+
+37 bottles of beer on the wall, 37 bottles of beer.
+Take one down and pass it around, 36 bottles of beer on the wall.
+
+36 bottles of beer on the wall, 36 bottles of beer.
+Take one down and pass it around, 35 bottles of beer on the wall.
+
+35 bottles of beer on the wall, 35 bottles of beer.
+Take one down and pass it around, 34 bottles of beer on the wall.
+
+34 bottles of beer on the wall, 34 bottles of beer.
+Take one down and pass it around, 33 bottles of beer on the wall.
+
+33 bottles of beer on the wall, 33 bottles of beer.
+Take one down and pass it around, 32 bottles of beer on the wall.
+
+32 bottles of beer on the wall, 32 bottles of beer.
+Take one down and pass it around, 31 bottles of beer on the wall.
+
+31 bottles of beer on the wall, 31 bottles of beer.
+Take one down and pass it around, 30 bottles of beer on the wall.
+
+30 bottles of beer on the wall, 30 bottles of beer.
+Take one down and pass it around, 29 bottles of beer on the wall.
+
+29 bottles of beer on the wall, 29 bottles of beer.
+Take one down and pass it around, 28 bottles of beer on the wall.
+
+28 bottles of beer on the wall, 28 bottles of beer.
+Take one down and pass it around, 27 bottles of beer on the wall.
+
+27 bottles of beer on the wall, 27 bottles of beer.
+Take one down and pass it around, 26 bottles of beer on the wall.
+
+26 bottles of beer on the wall, 26 bottles of beer.
+Take one down and pass it around, 25 bottles of beer on the wall.
+
+25 bottles of beer on the wall, 25 bottles of beer.
+Take one down and pass it around, 24 bottles of beer on the wall.
+
+24 bottles of beer on the wall, 24 bottles of beer.
+Take one down and pass it around, 23 bottles of beer on the wall.
+
+23 bottles of beer on the wall, 23 bottles of beer.
+Take one down and pass it around, 22 bottles of beer on the wall.
+
+22 bottles of beer on the wall, 22 bottles of beer.
+Take one down and pass it around, 21 bottles of beer on the wall.
+
+21 bottles of beer on the wall, 21 bottles of beer.
+Take one down and pass it around, 20 bottles of beer on the wall.
+
+20 bottles of beer on the wall, 20 bottles of beer.
+Take one down and pass it around, 19 bottles of beer on the wall.
+
+19 bottles of beer on the wall, 19 bottles of beer.
+Take one down and pass it around, 18 bottles of beer on the wall.
+
+18 bottles of beer on the wall, 18 bottles of beer.
+Take one down and pass it around, 17 bottles of beer on the wall.
+
+17 bottles of beer on the wall, 17 bottles of beer.
+Take one down and pass it around, 16 bottles of beer on the wall.
+
+16 bottles of beer on the wall, 16 bottles of beer.
+Take one down and pass it around, 15 bottles of beer on the wall.
+
+15 bottles of beer on the wall, 15 bottles of beer.
+Take one down and pass it around, 14 bottles of beer on the wall.
+
+14 bottles of beer on the wall, 14 bottles of beer.
+Take one down and pass it around, 13 bottles of beer on the wall.
+
+13 bottles of beer on the wall, 13 bottles of beer.
+Take one down and pass it around, 12 bottles of beer on the wall.
+
+12 bottles of beer on the wall, 12 bottles of beer.
+Take one down and pass it around, 11 bottles of beer on the wall.
+
+11 bottles of beer on the wall, 11 bottles of beer.
+Take one down and pass it around, 10 bottles of beer on the wall.
+
+10 bottles of beer on the wall, 10 bottles of beer.
+Take one down and pass it around, 9 bottles of beer on the wall.
+
+9 bottles of beer on the wall, 9 bottles of beer.
+Take one down and pass it around, 8 bottles of beer on the wall.
+
+8 bottles of beer on the wall, 8 bottles of beer.
+Take one down and pass it around, 7 bottles of beer on the wall.
+
+7 bottles of beer on the wall, 7 bottles of beer.
+Take one down and pass it around, 6 bottles of beer on the wall.
+
+6 bottles of beer on the wall, 6 bottles of beer.
+Take one down and pass it around, 5 bottles of beer on the wall.
+
+5 bottles of beer on the wall, 5 bottles of beer.
+Take one down and pass it around, 4 bottles of beer on the wall.
+
+4 bottles of beer on the wall, 4 bottles of beer.
+Take one down and pass it around, 3 bottles of beer on the wall.
+
+3 bottles of beer on the wall, 3 bottles of beer.
+Take one down and pass it around, 2 bottles of beer on the wall.
+
+2 bottles of beer on the wall, 2 bottles of beer.
+Take one down and pass it around, 1 bottle of beer on the wall.
+
+1 bottle of beer on the wall, 1 bottle of beer.
+Take it down and pass it around, no more bottles of beer on the wall.
+
+No more bottles of beer on the wall, no more bottles of beer.
+Go to the store and buy some more, 99 bottles of beer on the wall.
+"""
+ assertEquals(expected, BeerSong.lyrics)
+ }
+}
diff --git a/kotlin/isogram/.idea/workspace.xml b/kotlin/isogram/.idea/workspace.xml
index 28ef3dd..573ca2b 100644
--- a/kotlin/isogram/.idea/workspace.xml
+++ b/kotlin/isogram/.idea/workspace.xml
@@ -35,8 +35,8 @@
-
-
+
+
@@ -415,8 +415,6 @@
-
-
@@ -445,11 +443,13 @@
+
+
-
+
@@ -765,6 +765,19 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
@@ -877,7 +890,7 @@
-
+
@@ -926,6 +939,33 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
@@ -1004,8 +1044,8 @@
-
-
+
+
diff --git a/kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin b/kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin
new file mode 100644
index 0000000..f76dd23
Binary files /dev/null and b/kotlin/nucleotide-count/.gradle/3.5/file-changes/last-build.bin differ
diff --git a/kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock b/kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock
new file mode 100644
index 0000000..6db3942
Binary files /dev/null and b/kotlin/nucleotide-count/.gradle/3.5/taskHistory/taskHistory.lock differ
diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/built.bin b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/built.bin
new file mode 100644
index 0000000..e69de29
diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties
new file mode 100644
index 0000000..4960bbd
--- /dev/null
+++ b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties
@@ -0,0 +1,2 @@
+#Mon Jun 05 13:06:39 EDT 2017
+gradle.version=3.5
diff --git a/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock
new file mode 100644
index 0000000..40fdece
--- /dev/null
+++ b/kotlin/nucleotide-count/.gradle/buildOutputCleanup/cache.properties.lock
@@ -0,0 +1 @@
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/compiler.xml b/kotlin/nucleotide-count/.idea/compiler.xml
new file mode 100644
index 0000000..b966427
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/compiler.xml
@@ -0,0 +1,9 @@
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/gradle.xml b/kotlin/nucleotide-count/.idea/gradle.xml
new file mode 100644
index 0000000..346dc7e
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/gradle.xml
@@ -0,0 +1,19 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml
new file mode 100644
index 0000000..04c10dd
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__junit_junit_4_12.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
new file mode 100644
index 0000000..8262f72
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_hamcrest_hamcrest_core_1_3.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
new file mode 100644
index 0000000..4f32fde
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_annotations_13_0.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
new file mode 100644
index 0000000..7b6f562
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_stdlib_1_1_1.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
new file mode 100644
index 0000000..1720158
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_1_1_1.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
new file mode 100644
index 0000000..21c5d19
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/libraries/Gradle__org_jetbrains_kotlin_kotlin_test_junit_1_1_1.xml
@@ -0,0 +1,11 @@
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/misc.xml b/kotlin/nucleotide-count/.idea/misc.xml
new file mode 100644
index 0000000..3e1805e
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/misc.xml
@@ -0,0 +1,22 @@
+
+
+
+
+
+
+
+
+
+ 1.8
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/modules.xml b/kotlin/nucleotide-count/.idea/modules.xml
new file mode 100644
index 0000000..9577d35
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/modules.xml
@@ -0,0 +1,10 @@
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml
new file mode 100644
index 0000000..fdd4f60
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count.iml
@@ -0,0 +1,12 @@
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml
new file mode 100644
index 0000000..c5d4e65
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_main.iml
@@ -0,0 +1,40 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml
new file mode 100644
index 0000000..da0b300
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/modules/nucleotide-count_test.iml
@@ -0,0 +1,46 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/.idea/workspace.xml b/kotlin/nucleotide-count/.idea/workspace.xml
new file mode 100644
index 0000000..ee6defe
--- /dev/null
+++ b/kotlin/nucleotide-count/.idea/workspace.xml
@@ -0,0 +1,1076 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/README.md b/kotlin/nucleotide-count/README.md
new file mode 100644
index 0000000..97cebdf
--- /dev/null
+++ b/kotlin/nucleotide-count/README.md
@@ -0,0 +1,35 @@
+# Nucleotide Count
+
+Given a DNA string, compute how many times each nucleotide occurs in the string.
+
+DNA is represented by an alphabet of the following symbols: 'A', 'C',
+'G', and 'T'.
+
+Each symbol represents a nucleotide, which is a fancy name for the
+particular molecules that happen to make up a large part of DNA.
+
+Shortest intro to biochemistry EVAR:
+
+- twigs are to birds nests as
+- nucleotides are to DNA and RNA as
+- amino acids are to proteins as
+- sugar is to starch as
+- oh crap lipids
+
+I'm not going to talk about lipids because they're crazy complex.
+
+So back to nucleotides.
+
+DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
+(`G`), and thymine (`T`).
+
+RNA contains a slightly different set of nucleotides, but we don't care
+about that for now.
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
+
diff --git a/kotlin/nucleotide-count/build.gradle b/kotlin/nucleotide-count/build.gradle
new file mode 100644
index 0000000..16c36c0
--- /dev/null
+++ b/kotlin/nucleotide-count/build.gradle
@@ -0,0 +1,28 @@
+buildscript {
+ ext.kotlin_version = '1.1.1'
+ repositories {
+ mavenCentral()
+ }
+ dependencies {
+ classpath "org.jetbrains.kotlin:kotlin-gradle-plugin:$kotlin_version"
+ }
+}
+
+apply plugin: 'kotlin'
+
+repositories {
+ mavenCentral()
+}
+
+dependencies {
+ compile "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version"
+
+ testCompile 'junit:junit:4.12'
+ testCompile "org.jetbrains.kotlin:kotlin-test-junit:$kotlin_version"
+}
+test {
+ testLogging {
+ exceptionFormat = 'full'
+ events = ["passed", "failed", "skipped"]
+ }
+}
diff --git a/kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class b/kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class
new file mode 100644
index 0000000..d0e8581
Binary files /dev/null and b/kotlin/nucleotide-count/build/classes/main/DNA$nucleotideCounts$2.class differ
diff --git a/kotlin/nucleotide-count/build/classes/main/DNA.class b/kotlin/nucleotide-count/build/classes/main/DNA.class
new file mode 100644
index 0000000..29099d1
Binary files /dev/null and b/kotlin/nucleotide-count/build/classes/main/DNA.class differ
diff --git a/kotlin/nucleotide-count/build/classes/test/NucleotideTest.class b/kotlin/nucleotide-count/build/classes/test/NucleotideTest.class
new file mode 100644
index 0000000..8e8290b
Binary files /dev/null and b/kotlin/nucleotide-count/build/classes/test/NucleotideTest.class differ
diff --git a/kotlin/nucleotide-count/build/kotlin-build/caches/version.txt b/kotlin/nucleotide-count/build/kotlin-build/caches/version.txt
new file mode 100644
index 0000000..01aabac
--- /dev/null
+++ b/kotlin/nucleotide-count/build/kotlin-build/caches/version.txt
@@ -0,0 +1 @@
+11001
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/src/main/kotlin/.keep b/kotlin/nucleotide-count/src/main/kotlin/.keep
new file mode 100644
index 0000000..e69de29
diff --git a/kotlin/nucleotide-count/src/main/kotlin/DNA.kt b/kotlin/nucleotide-count/src/main/kotlin/DNA.kt
new file mode 100644
index 0000000..0571faa
--- /dev/null
+++ b/kotlin/nucleotide-count/src/main/kotlin/DNA.kt
@@ -0,0 +1,23 @@
+class DNA(val nucleotides: String) {
+ val nucleotideCounts: MutableMap by lazy {
+ for (i in nucleotides){
+ print(i)
+ if (!((i == 'A') or (i == 'C') or (i == 'G') or (i == 'T'))) throw IllegalArgumentException()
+ }
+ var tempMap: MutableMap = emptyMap().toMutableMap()
+ tempMap.put('A', 0)
+ tempMap.put('C', 0)
+ tempMap.put('G', 0)
+ tempMap.put('T', 0)
+
+ for (i in tempMap){
+ tempMap.put(i.key, nucleotides.count { it == i.key })
+ }
+
+ tempMap
+ }
+
+ fun count(testChar: Char): Int{
+ return nucleotideCounts.getOrDefault(testChar, 0)
+ }
+}
\ No newline at end of file
diff --git a/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt b/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt
new file mode 100644
index 0000000..80b4ccc
--- /dev/null
+++ b/kotlin/nucleotide-count/src/test/kotlin/NucleotideTest.kt
@@ -0,0 +1,87 @@
+import org.junit.Test
+import org.junit.Ignore;
+import kotlin.test.assertEquals
+
+class NucleotideTest {
+
+
+ @Test
+ fun emptyDnaStringHasNoAdenosine() {
+ val dna = DNA("");
+
+ assertEquals(0, dna.count('A'))
+ }
+
+
+ @Test
+ fun emptyDnaStringHasNoNucleotides() {
+ val dna = DNA("");
+ val expected = mapOf('A' to 0, 'C' to 0, 'G' to 0, 'T' to 0)
+
+ assertEquals(expected, dna.nucleotideCounts)
+ }
+
+
+ @Test
+ fun repetitiveCytidineGetsCounted() {
+ val dna = DNA("CCCCC");
+ assertEquals(5, dna.count('C'))
+ }
+
+
+ @Test
+ fun repetitiveSequenceWithOnlyGuanosine() {
+ val dna = DNA("GGGGGGGG");
+ val expected = mapOf('A' to 0, 'C' to 0, 'G' to 8, 'T' to 0)
+
+ assertEquals(expected, dna.nucleotideCounts)
+ }
+
+
+ @Test
+ fun countsOnlyThymidine() {
+ val dna = DNA("GGGGGTAACCCGG");
+
+ assertEquals(1, dna.count('T'))
+ }
+
+
+ @Test
+ fun countsANucleotideOnlyOnce() {
+ val dna = DNA("CGATTGGG");
+
+ dna.count('T')
+ assertEquals(2, dna.count('T'))
+ }
+
+
+ @Test
+ fun dnaCountsDoNotChangeAfterCountingAdenosine() {
+ val dna = DNA("GATTACA");
+ val expected = mapOf('A' to 3, 'C' to 1, 'G' to 1, 'T' to 2)
+
+ dna.count('A');
+ assertEquals(expected, dna.nucleotideCounts)
+ }
+
+
+ @Test(expected = IllegalArgumentException::class)
+ fun validatesNucleotides() {
+ DNA("GX")
+ }
+
+
+ @Test(expected = IllegalArgumentException::class)
+ fun validatesNucleotidesCountInput() {
+ DNA("GACT").count('X');
+ }
+
+
+ @Test
+ fun countsAllNucleotides() {
+ val dna = DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
+ val expected = mapOf('A' to 20, 'C' to 12, 'G' to 17, 'T' to 21)
+
+ assertEquals(expected, dna.nucleotideCounts)
+ }
+}
diff --git a/kotlin/space-age/.idea/workspace.xml b/kotlin/space-age/.idea/workspace.xml
index 6120b39..e12f037 100644
--- a/kotlin/space-age/.idea/workspace.xml
+++ b/kotlin/space-age/.idea/workspace.xml
@@ -35,7 +35,7 @@
-
+
@@ -484,7 +484,7 @@
-
+